Human MYL1/MLC1F/ MLC3F ORF/cDNA clone-Lentivirus plasmid (NM_079422)

Pre-made Human MYL1/MLC1F/ MLC3F Lentiviral expression plasmid for MYL1 lentivirus packaging, MYL1 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.

Target products collectionGo to MYL1/MLC1F products collection >>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)



Product information

Catalog No. Product Name Plasmid Grade Plasmid quantity
pGMLP000342 Human MYL1 Lentivirus plasmid Research Grade 10mg, 50mg, 100mg, 500mg, >1g
GMP-like Grade 10mg, 50mg, 100mg, 500mg, >1g
High Quality (HQ) Grade
Seed 5ug


Product Description

Catalog ID pGMLP000342
Gene Name MYL1
Accession Number NM_079422
Gene ID 4632
Species Human
Product Type Lentivirus plasmid (overexpression)
Insert Length 453 bp
Gene Alias MLC1F, MLC3F
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
Sequence ATGTCCTTCAGTGCTGACCAGATTGCTGAATTCAAGGAGGCATTTCTCCTGTTTGACAGAACAGGTGATTCCAAGATCACCTTAAGCCAGGTCGGTGATGTCCTTCGAGCTCTGGGCACAAATCCCACCAATGCAGAGGTCAGGAAAGTTCTGGGAAACCCCAGCAATGAAGAGCTGAATGCCAAGAAAATTGAGTTTGAACAATTTCTGCCTATGATGCAAGCCATTTCCAACAACAAGGACCAGGCCACCTATGAAGACTTTGTTGAGGGTCTGCGTGTCTTTGACAAGGAAGGCAATGGCACAGTCATGGGTGCTGAACTCCGCCATGTTCTAGCCACCCTGGGTGAAAAGATGAAAGAGGAAGAAGTGGAAGCCCTGATGGCAGGTCAAGAAGACTCCAATGGCTGCATCAACTACGAAGCTTTTGTCAAGCACATCATGTCTATCTGA

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-SE1588-Ab Anti-MYL1/ MLC1F/ MLC3F functional antibody
    Target Antigen GM-Tg-g-SE1588-Ag MYL1 protein
    ORF Viral Vector pGMLP000342 Human MYL1 Lentivirus plasmid
    ORF Viral Vector vGMLP000342 Human MYL1 Lentivirus particle


    Target information

    Target ID GM-SE1588
    Target Name MYL1
    Gene ID 4632, 17901, 711561, 56781, 101099140, 478896, 317657, 100052501
    Gene Symbol and Synonyms CMYP14,Mcl3,MLC-1,MLC-f,MLC1,MLC1/3,MLC1F,Mlc3,MLC3-f,MLC3F,MLCf,MYL1,Mylf,MYOFTA
    Uniprot Accession P05976
    Uniprot Entry Name MYL1_HUMAN
    Protein Sub-location Secreted Protein/Potential Cytokines
    Category Not Available
    Disease Not Available
    Gene Ensembl ENSG00000168530
    Target Classification Not Available

    Myosin is a hexameric ATPase cellular motor protein. It is composed of two heavy chains, two nonphosphorylatable alkali light chains, and two phosphorylatable regulatory light chains. This gene encodes a myosin alkali light chain expressed in fast skeletal muscle. Two transcript variants have been identified for this gene. [provided by RefSeq, Jul 2008]



    About GMVC

    GDU



    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.