Human MCFD2/F5F8D/ F5F8D2 ORF/cDNA clone-Lentivirus plasmid (NM_139279)

Pre-made Human MCFD2/F5F8D/ F5F8D2 Lentiviral expression plasmid for MCFD2 lentivirus packaging, MCFD2 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.

Target products collectionGo to MCFD2/F5F8D products collection >>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)



Product information

Catalog No. Product Name Plasmid Grade Plasmid quantity
pGMLP000374 Human MCFD2 Lentivirus plasmid Research Grade 10mg, 50mg, 100mg, 500mg, >1g
GMP-like Grade 10mg, 50mg, 100mg, 500mg, >1g
High Quality (HQ) Grade
Seed 5ug


Product Description

Catalog ID pGMLP000374
Gene Name MCFD2
Accession Number NM_139279
Gene ID 90411
Species Human
Product Type Lentivirus plasmid (overexpression)
Insert Length 441 bp
Gene Alias F5F8D, F5F8D2, LMAN1IP, SDNSF
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
Sequence ATGACCATGAGATCCCTGCTCAGAACCCCCTTCCTGTGTGGCCTGCTCTGGGCCTTTTGTGCCCCAGGCGCCAGGGCTGAGGAGCCTGCAGCCAGCTTCTCCCAACCCGGCAGCATGGGCCTGGATAAGAACACAGTGCACGACCAAGAGCATATCATGGAGCATCTAGAAGGTGTCATCAACAAACCAGAGGCGGAGATGTCGCCACAAGAATTGCAGCTCCATTACTTCAAAATGCATGATTATGATGGCAATAATTTGCTTGATGGCTTAGAACTCTCCACAGCCATCACTCATGTCCATAAGGAGGAAGGGAGTGAACAGGCACCACTAATGAGTGAAGATGAACTGATTAACATAATAGATGGTGTTTTGAGAGATGATGACAAGAACAATGATGGATACATTGACTATGCTGAATTTGCAAAATCACTGCAGTAG

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-SE1626-Ab Anti-MCFD2/ F5F8D/ F5F8D2 functional antibody
    Target Antigen GM-Tg-g-SE1626-Ag MCFD2 protein
    ORF Viral Vector pGMLP000374 Human MCFD2 Lentivirus plasmid
    ORF Viral Vector vGMLP000374 Human MCFD2 Lentivirus particle


    Target information

    Target ID GM-SE1626
    Target Name MCFD2
    Gene ID 90411, 193813, 717900, 246117, 101081285, 474582, 616647, 100068298
    Gene Symbol and Synonyms 1810021C21Rik,F5F8D,F5F8D2,LMAN1IP,MCFD2,SDNSF
    Uniprot Accession Q8NI22
    Uniprot Entry Name MCFD2_HUMAN
    Protein Sub-location Secreted Protein/Potential Cytokines
    Category Not Available
    Disease Not Available
    Gene Ensembl ENSG00000180398
    Target Classification Not Available

    This gene encodes a soluble luminal protein with two calmodulin-like EF-hand motifs at its C-terminus. This protein forms a complex with LMAN1 (lectin mannose binding protein 1; also known as ERGIC-53) that facilitates the transport of coagulation factors V (FV) and VIII (FVIII) from the endoplasmic reticulum to the Golgi apparatus via an endoplasmic reticulum Golgi intermediate compartment (ERGIC). Mutations in this gene cause combined deficiency of FV and FVIII (F5F8D); a rare autosomal recessive bleeding disorder characterized by mild to moderate bleeding and coordinate reduction in plasma FV and FVIII levels. This protein has also been shown to maintain stem cell potential in adult central nervous system and is a marker for testicular germ cell tumors. The 3' UTR of this gene contains a transposon-like human repeat element named 'THE 1'. A processed RNA pseudogene of this gene is on chromosome 6p22.1. Alternative splicing results in multiple transcript variants encoding distinct isoforms. [provided by RefSeq, Apr 2016]



    About GMVC

    GDU



    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.