Human MCFD2/F5F8D/ F5F8D2 ORF/cDNA clone-Lentivirus particle (NM_139279)
Pre-made Human MCFD2/F5F8D/ F5F8D2 Lentiviral expression plasmid for MCFD2 lentivirus packaging, MCFD2 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.
The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.
Go
to MCFD2/F5F8D products collection
>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product information
Catalog No. | Product Name | lentivirus Grade | lentivirus quantity |
---|---|---|---|
vGMLP000374 | Human MCFD2 Lentivirus particle | Pilot Grade | 1.0E+8TU |
5.0E+8TU | |||
1.0E+9TU | |||
Research Grade | 1.0E+8TU | ||
5.0E+8TU | |||
1.0E+9TU | |||
GMP-like Grade | inquiry | ||
GMP Grade | inquiry |
Product Description
Catalog ID | vGMLP000374 |
Gene Name | MCFD2 |
Accession Number | NM_139279 |
Gene ID | 90411 |
Species | Human |
Product Type | Lentivirus particle (overexpression) |
Insert Length | 441 bp |
Gene Alias | F5F8D, F5F8D2, LMAN1IP, SDNSF |
Fluorescent Reporter | ZsGreen |
Mammalian Cell Selection | Puromyocin |
Fusion Tag | 3xflag (C-Terminal) |
Promoter | CMV |
Resistance | Amplicin |
Sequence | ATGACCATGAGATCCCTGCTCAGAACCCCCTTCCTGTGTGGCCTGCTCTGGGCCTTTTGTGCCCCAGGCGCCAGGGCTGAGGAGCCTGCAGCCAGCTTCTCCCAACCCGGCAGCATGGGCCTGGATAAGAACACAGTGCACGACCAAGAGCATATCATGGAGCATCTAGAAGGTGTCATCAACAAACCAGAGGCGGAGATGTCGCCACAAGAATTGCAGCTCCATTACTTCAAAATGCATGATTATGATGGCAATAATTTGCTTGATGGCTTAGAACTCTCCACAGCCATCACTCATGTCCATAAGGAGGAAGGGAGTGAACAGGCACCACTAATGAGTGAAGATGAACTGATTAACATAATAGATGGTGTTTTGAGAGATGATGACAAGAACAATGATGGATACATTGACTATGCTGAATTTGCAAAATCACTGCAGTAG |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
Category | Cat No. | Products Name |
---|---|---|
Target Antibody | GM-Tg-g-SE1626-Ab | Anti-MCFD2/ F5F8D/ F5F8D2 functional antibody |
Target Antigen | GM-Tg-g-SE1626-Ag | MCFD2 protein |
ORF Viral Vector | pGMLP000374 | Human MCFD2 Lentivirus plasmid |
ORF Viral Vector | vGMLP000374 | Human MCFD2 Lentivirus particle |
Target information
Target ID | GM-SE1626 |
Target Name | MCFD2 |
Gene ID | 90411, 193813, 717900, 246117, 101081285, 474582, 616647, 100068298 |
Gene Symbol and Synonyms | 1810021C21Rik,F5F8D,F5F8D2,LMAN1IP,MCFD2,SDNSF |
Uniprot Accession | Q8NI22 |
Uniprot Entry Name | MCFD2_HUMAN |
Protein Sub-location | Secreted Protein/Potential Cytokines |
Category | Not Available |
Disease | Not Available |
Gene Ensembl | ENSG00000180398 |
Target Classification | Not Available |
This gene encodes a soluble luminal protein with two calmodulin-like EF-hand motifs at its C-terminus. This protein forms a complex with LMAN1 (lectin mannose binding protein 1; also known as ERGIC-53) that facilitates the transport of coagulation factors V (FV) and VIII (FVIII) from the endoplasmic reticulum to the Golgi apparatus via an endoplasmic reticulum Golgi intermediate compartment (ERGIC). Mutations in this gene cause combined deficiency of FV and FVIII (F5F8D); a rare autosomal recessive bleeding disorder characterized by mild to moderate bleeding and coordinate reduction in plasma FV and FVIII levels. This protein has also been shown to maintain stem cell potential in adult central nervous system and is a marker for testicular germ cell tumors. The 3' UTR of this gene contains a transposon-like human repeat element named 'THE 1'. A processed RNA pseudogene of this gene is on chromosome 6p22.1. Alternative splicing results in multiple transcript variants encoding distinct isoforms. [provided by RefSeq, Apr 2016]
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.