Human UCN2/SRP/UCN-II ORF/cDNA clone-Lentivirus plasmid (NM_033199)

Cat. No.: pGMLP000406
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days

Pre-made Human UCN2/SRP/UCN-II Lentiviral expression plasmid for UCN2 lentivirus packaging, UCN2 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.


Target products collection

Go to UCN2/SRP products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Purchase
Total Price: $450
Shipping fee: Limited-time free
For payment issues, contact us.


Product Description

Catalog ID pGMLP000406
Gene Name UCN2
Accession Number NM_033199
Gene ID 90226
Species Human
Product Type Lentivirus plasmid (overexpression)
Insert Length 339 bp
Gene Alias SRP,UCN-II,UCNI,UR,URP
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGACCAGGTGTGCTCTGCTGTTGCTGATGGTCCTGATGTTGGGCAGAGTCCTGGTTGTCCCAGTGACCCCTATCCCAACCTTCCAGCTCCGCCCTCAGAATTCTCCCCAGACCACTCCCCGACCTGCGGCCTCAGAGAGCCCCTCAGCTGCTCCCACATGGCCGTGGGCTGCCCAGAGCCACTGCAGCCCCACCCGCCACCCTGGCTCGCGCATTGTCCTATCGCTGGATGTCCCCATCGGCCTCTTGCAGATCTTACTGGAGCAAGCCCGGGCCAGGGCTGCCAGGGAGCAGGCCACCACCAACGCCCGCATCCTGGCCCGTGTCGGCCACTGCTGA
ORF Protein Sequence MTRCALLLLMVLMLGRVLVVPVTPIPTFQLRPQNSPQTTPRPAASESPSAAPTWPWAAQSHCSPTRHPGSRIVLSLDVPIGLLQILLEQARARAAREQATTNARILARVGHC

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-SE0533-Ab Anti-UCN2/ SRP/ UCN-II functional antibody
    Target Antigen GM-Tg-g-SE0533-Ag UCN2 protein
    ORF Viral Vector pGMLP000406 Human UCN2 Lentivirus plasmid
    ORF Viral Vector vGMLP000406 Human UCN2 Lentivirus particle


    Target information

    Target ID GM-SE0533
    Target Name UCN2
    Gene ID 90226, 171530, 106996925, 170896, 101088991, 100683848, 751828
    Gene Symbol and Synonyms SRP,Ucn II,Ucn-2,UCN-II,UCN2,Ucn3,UCNI,UR,URP
    Uniprot Accession Q96RP3
    Uniprot Entry Name UCN2_HUMAN
    Protein Sub-location Secreted Protein/Potential Cytokines
    Category Not Available
    Disease Not Available
    Gene Ensembl ENSG00000145040
    Target Classification Not Available

    This gene is a member of the sauvagine/corticotropin-releasing factor/urotensin I family. It is structurally related to the corticotropin-releasing factor (CRF) gene and the encoded product is an endogenous ligand for CRF type 2 receptors. In the brain it may be responsible for the effects of stress on appetite. In spite of the gene family name similarity, the product of this gene has no sequence similarity to urotensin II. [provided by RefSeq, Jul 2008]



    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.