Human UCN2/SRP/UCN-II ORF/cDNA clone-Lentivirus plasmid (NM_033199)
Cat. No.: pGMLP000406
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days
Pre-made Human UCN2/SRP/UCN-II Lentiviral expression plasmid for UCN2 lentivirus packaging, UCN2 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.
Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.
Go to
UCN2/SRP products
collection>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product Description
Catalog ID | pGMLP000406 |
Gene Name | UCN2 |
Accession Number | NM_033199 |
Gene ID | 90226 |
Species | Human |
Product Type | Lentivirus plasmid (overexpression) |
Insert Length | 339 bp |
Gene Alias | SRP,UCN-II,UCNI,UR,URP |
Fluorescent Reporter | ZsGreen |
Mammalian Cell Selection | Puromyocin |
Fusion Tag | 3xflag (C-Terminal) |
Promoter | CMV |
Resistance | Amplicin |
ORF Nucleotide Sequence | ATGACCAGGTGTGCTCTGCTGTTGCTGATGGTCCTGATGTTGGGCAGAGTCCTGGTTGTCCCAGTGACCCCTATCCCAACCTTCCAGCTCCGCCCTCAGAATTCTCCCCAGACCACTCCCCGACCTGCGGCCTCAGAGAGCCCCTCAGCTGCTCCCACATGGCCGTGGGCTGCCCAGAGCCACTGCAGCCCCACCCGCCACCCTGGCTCGCGCATTGTCCTATCGCTGGATGTCCCCATCGGCCTCTTGCAGATCTTACTGGAGCAAGCCCGGGCCAGGGCTGCCAGGGAGCAGGCCACCACCAACGCCCGCATCCTGGCCCGTGTCGGCCACTGCTGA |
ORF Protein Sequence | MTRCALLLLMVLMLGRVLVVPVTPIPTFQLRPQNSPQTTPRPAASESPSAAPTWPWAAQSHCSPTRHPGSRIVLSLDVPIGLLQILLEQARARAAREQATTNARILARVGHC |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
Category | Cat No. | Products Name |
---|---|---|
Target Antibody | GM-Tg-g-SE0533-Ab | Anti-UCN2/ SRP/ UCN-II functional antibody |
Target Antigen | GM-Tg-g-SE0533-Ag | UCN2 protein |
ORF Viral Vector | pGMLP000406 | Human UCN2 Lentivirus plasmid |
ORF Viral Vector | vGMLP000406 | Human UCN2 Lentivirus particle |
Target information
Target ID | GM-SE0533 |
Target Name | UCN2 |
Gene ID | 90226, 171530, 106996925, 170896, 101088991, 100683848, 751828 |
Gene Symbol and Synonyms | SRP,Ucn II,Ucn-2,UCN-II,UCN2,Ucn3,UCNI,UR,URP |
Uniprot Accession | Q96RP3 |
Uniprot Entry Name | UCN2_HUMAN |
Protein Sub-location | Secreted Protein/Potential Cytokines |
Category | Not Available |
Disease | Not Available |
Gene Ensembl | ENSG00000145040 |
Target Classification | Not Available |
This gene is a member of the sauvagine/corticotropin-releasing factor/urotensin I family. It is structurally related to the corticotropin-releasing factor (CRF) gene and the encoded product is an endogenous ligand for CRF type 2 receptors. In the brain it may be responsible for the effects of stress on appetite. In spite of the gene family name similarity, the product of this gene has no sequence similarity to urotensin II. [provided by RefSeq, Jul 2008]
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.