Human CD69/AIM/BL-AC/P26 ORF/cDNA clone-Lentivirus plasmid (NM_001781)
Cat. No.: pGMLP000408
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days
Pre-made Human CD69/AIM/BL-AC/P26 Lentiviral expression plasmid for CD69 lentivirus packaging, CD69 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.
Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.
Go to
CD69/AIM products
collection>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product Description
Catalog ID | pGMLP000408 |
Gene Name | CD69 |
Accession Number | NM_001781 |
Gene ID | 969 |
Species | Human |
Product Type | Lentivirus plasmid (overexpression) |
Insert Length | 600 bp |
Gene Alias | AIM,BL-AC/P26,CLEC2C,EA1,GP32/28,MLR-3 |
Fluorescent Reporter | ZsGreen |
Mammalian Cell Selection | Puromyocin |
Fusion Tag | 3xflag (C-Terminal) |
Promoter | CMV |
Resistance | Amplicin |
ORF Nucleotide Sequence | ATGAGCTCTGAAAATTGTTTCGTAGCAGAGAACAGCTCTTTGCATCCGGAGAGTGGACAAGAAAATGATGCCACCAGTCCCCATTTCTCAACACGTCATGAAGGGTCCTTCCAAGTTCCTGTCCTGTGTGCTGTAATGAATGTGGTCTTCATCACCATTTTAATCATAGCTCTCATTGCCTTATCAGTGGGCCAATACAATTGTCCAGGCCAATACACATTCTCAATGCCATCAGACAGCCATGTTTCTTCATGCTCTGAGGACTGGGTTGGCTACCAGAGGAAATGCTACTTTATTTCTACTGTGAAGAGGAGCTGGACTTCAGCCCAAAATGCTTGTTCTGAACATGGTGCTACTCTTGCTGTCATTGATTCTGAAAAGGACATGAACTTTCTAAAACGATACGCAGGTAGAGAGGAACACTGGGTTGGACTGAAAAAGGAACCTGGTCACCCATGGAAGTGGTCAAATGGCAAAGAATTTAACAACTGGTTCAACGTTACAGGGTCTGACAAGTGTGTTTTTCTGAAAAACACAGAGGTCAGCAGCATGGAATGTGAGAAGAATTTATACTGGATATGTAACAAACCTTACAAATAA |
ORF Protein Sequence | MSSENCFVAENSSLHPESGQENDATSPHFSTRHEGSFQVPVLCAVMNVVFITILIIALIALSVGQYNCPGQYTFSMPSDSHVSSCSEDWVGYQRKCYFISTVKRSWTSAQNACSEHGATLAVIDSEKDMNFLKRYAGREEHWVGLKKEPGHPWKWSNGKEFNNWFNVTGSDKCVFLKNTEVSSMECEKNLYWICNKPYK |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
Category | Cat No. | Products Name |
---|---|---|
Target Antibody | GM-Tg-g-IP0188-Ab | Anti-CD69 monoclonal antibody |
Target Antigen | GM-Tg-g-IP0188-Ag | CD69 protein |
ORF Viral Vector | pGMLP000408 | Human CD69 Lentivirus plasmid |
ORF Viral Vector | pGMAP000449 | Human CD69 Adenovirus plasmid |
ORF Viral Vector | vGMLP000408 | Human CD69 Lentivirus particle |
ORF Viral Vector | vGMAP000449 | Human CD69 Adenovirus particle |
Target information
Target ID | GM-IP0188 |
Target Name | CD69 |
Gene ID | 969, 717288, 29187, 101082498, 477698, 281058, 100053615 |
Gene Symbol and Synonyms | AIM,BL-AC/P26,CD69,CLEC2C,EA1,GP32/28,MLR-3 |
Uniprot Accession | Q07108 |
Uniprot Entry Name | CD69_HUMAN |
Protein Sub-location | Introcelluar Protein |
Category | Not Available |
Disease | Cancer |
Gene Ensembl | ENSG00000110848 |
Target Classification | Tumor-associated antigen (TAA) |
This gene encodes a member of the calcium dependent lectin superfamily of type II transmembrane receptors. Expression of the encoded protein is induced upon activation of T lymphocytes, and may play a role in proliferation. Furthermore, the protein may act to transmit signals in natural killer cells and platelets. [provided by RefSeq, Aug 2011]
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.