Human CD69/CLEC2C ORF/cDNA clone-Adenovirus particle (BC007037)

Cat. No.: vGMAP000449

Pre-made Human CD69/CLEC2C Adenovirus for CD69 overexpression in-vitro and in-vivo. The CD69 adenoviral vector excels as a vehicle for transient gene transfection in both stable cell lines and primary cells, including DC cells, macrophages, cardiomyocytes, hepatocytes, and neurons. The purified CD69-encoding adenovirus also stands out as a quintessential tool for in vivo studies and vaccine research initiatives.

At GM Vector Core (GMVC), we provide bespoke adenovirus development and manufacture various grades of adenoviruses utilizing cutting-edge techniques. Dive deeper into our offerings.

Target products collection

Go to CD69/CLEC2C products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

pdf MSDS
pdf Datasheet

Product information

Catalog No. Product Name Adenovirus Grade Adenovirus quantity
vGMAP000449 Human CD69 Adenovirus particle Research Grade-In vitro 1E+10PFU (1E+10pfu/ml×1ml)
5E+10PFU (1E+10pfu/ml×5ml)
1E+11PFU (1E+10pfu/ml×10ml)
Research Grade-In vivo 1E+11PFU (1E+11pfu/ml×1ml)
GMP-like Grade inquiry
GMP Grade inquiry


Product Description

Catalog ID vGMAP000449
Gene Name CD69
Accession Number BC007037
Gene ID 969
Species Human
Product Type Adenovirus particle (overexpression)
Insert Length 600 bp
Gene Alias CLEC2C
Fluorescent Reporter GFP
Mammalian Cell Selection Null
Fusion Tag 3xflag (C-Terminal)
Promoter EF1
Resistance Amplicin
ORF Nucleotide Sequence ATGAGCTCTGAAAATTGTTTCGTAGCAGAGAACAGCTCTTTGCATCCGGAGAGTGGACAAGAAAATGATGCCACCAGTCCCCATTTCTCAACACGTCATGAAGGGTCCTTCCAAGTTCCTGTCCTGTGTGCTGTAATGAATGTGGTCTTCATCACCATTTTAATCATAGCTCTCATTGCCTTATCAGTGGGCCAATACAATTGTCCAGGCCAATACACATTCTCAATGCCATCAGACAGCCATGTTTCTTCATGCTCTGAGGACTGGGTTGGCTACCAGAGGAAATGCTACTTTATTTCTACTGTGAAGAGGAGCTGGACTTCAGCCCAAAATGCTTGTTCTGAACATGGTGCTACTCTTGCTGTCATTGATTCTGAAAAGGACATGAACTTTCTAAAACGATACGCAGGTAGAGAGGAACACTGGGTTGGACTGAAAAAGGAACCTGGTCACCCATGGAAGTGGTCAAATGGCAAAGAATTTAACAACTGGTTCAACGTTACAGGGTCTGACAAGTGTGTTTTTCTGAAAAACACAGAGGTCAGCAGCATGGAATGTGAGAAGAATTTATACTGGATATGTAACAAACCTTACAAATAA
ORF Protein Sequence MSSENCFVAENSSLHPESGQENDATSPHFSTRHEGSFQVPVLCAVMNVVFITILIIALIALSVGQYNCPGQYTFSMPSDSHVSSCSEDWVGYQRKCYFISTVKRSWTSAQNACSEHGATLAVIDSEKDMNFLKRYAGREEHWVGLKKEPGHPWKWSNGKEFNNWFNVTGSDKCVFLKNTEVSSMECEKNLYWICNKPYK

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-IP0188-Ab Anti-CD69 monoclonal antibody
    Target Antigen GM-Tg-g-IP0188-Ag CD69 protein
    ORF Viral Vector pGMLP000408 Human CD69 Lentivirus plasmid
    ORF Viral Vector pGMAP000449 Human CD69 Adenovirus plasmid
    ORF Viral Vector vGMLP000408 Human CD69 Lentivirus particle
    ORF Viral Vector vGMAP000449 Human CD69 Adenovirus particle


    Target information

    Target ID GM-IP0188
    Target Name CD69
    Gene ID 969, 717288, 29187, 101082498, 477698, 281058, 100053615
    Gene Symbol and Synonyms AIM,BL-AC/P26,CD69,CLEC2C,EA1,GP32/28,MLR-3
    Uniprot Accession Q07108
    Uniprot Entry Name CD69_HUMAN
    Protein Sub-location Introcelluar Protein
    Category Not Available
    Disease Cancer
    Gene Ensembl ENSG00000110848
    Target Classification Tumor-associated antigen (TAA)

    This gene encodes a member of the calcium dependent lectin superfamily of type II transmembrane receptors. Expression of the encoded protein is induced upon activation of T lymphocytes, and may play a role in proliferation. Furthermore, the protein may act to transmit signals in natural killer cells and platelets. [provided by RefSeq, Aug 2011]



    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.