Human IL11RA/CRSDA ORF/cDNA clone-Lentivirus plasmid (NM_001142784)
Pre-made Human IL11RA/CRSDA Lentiviral expression plasmid for IL11RA lentivirus packaging, IL11RA lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.
Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.
Go
to IL11RA/CRSDA products collection
>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product information
Catalog No. | Product Name | Plasmid Grade | Plasmid quantity |
---|---|---|---|
pGMLP000420 | Human IL11RA Lentivirus plasmid | Research Grade | 10mg, 50mg, 100mg, 500mg, >1g |
GMP-like Grade | 10mg, 50mg, 100mg, 500mg, >1g | ||
High Quality (HQ) Grade | |||
Seed | 5ug |
Product Description
Catalog ID | pGMLP000420 |
Gene Name | IL11RA |
Accession Number | NM_001142784 |
Gene ID | 3590 |
Species | Human |
Product Type | Lentivirus plasmid (overexpression) |
Insert Length | 1269 bp |
Gene Alias | CRSDA |
Fluorescent Reporter | ZsGreen |
Mammalian Cell Selection | Puromyocin |
Fusion Tag | 3xflag (C-Terminal) |
Promoter | CMV |
Resistance | Amplicin |
Sequence | ATGAGCAGCAGCTGCTCAGGGCTGAGCAGGGTCCTGGTGGCCGTGGCTACAGCCCTGGTGTCTGCCTCCTCCCCCTGCCCCCAGGCCTGGGGCCCCCCAGGGGTCCAGTATGGGCAGCCAGGCAGGTCCGTGAAGCTGTGTTGTCCTGGAGTGACTGCCGGGGACCCAGTGTCCTGGTTTCGGGATGGGGAGCCAAAGCTGCTCCAGGGACCTGACTCTGGGCTAGGGCATGAACTGGTCCTGGCCCAGGCAGACAGCACTGATGAGGGCACCTACATCTGCCAGACCCTGGATGGTGCACTTGGGGGCACAGTGACCCTGCAGCTGGGCTACCCTCCAGCCCGCCCTGTTGTCTCCTGCCAAGCAGCCGACTATGAGAACTTCTCTTGCACTTGGAGTCCCAGCCAGATCAGCGGTTTACCCACCCGCTACCTCACCTCCTACAGGAAGAAGACAGTCCTAGGAGCTGATAGCCAGAGGAGGAGTCCATCCACAGGGCCCTGGCCATGCCCACAGGATCCCCTAGGGGCTGCCCGCTGTGTTGTCCACGGGGCTGAGTTCTGGAGCCAGTACCGGATTAATGTGACTGAGGTGAACCCACTGGGTGCCAGCACACGCCTGCTGGATGTGAGCTTGCAGAGCATCTTGCGCCCTGACCCACCCCAGGGCCTGCGGGTAGAGTCAGTACCAGGTTACCCCCGACGCCTGCGAGCCAGCTGGACATACCCTGCCTCCTGGCCGTGCCAGCCCCACTTCCTGCTCAAGTTCCGTTTGCAGTACCGTCCGGCGCAGCATCCAGCCTGGTCCACGGTGGAGCCAGCTGGACTGGAGGAGGTGATCACAGATGCTGTGGCTGGGCTGCCCCATGCTGTACGAGTCAGTGCCCGGGACTTTCTAGATGCTGGCACCTGGAGCACCTGGAGCCCGGAGGCCTGGGGAACTCCGAGCACTGGGACCATACCAAAGGAGATACCAGCATGGGGCCAGCTACACACGCAGCCAGAGGTGGAGCCTCAGGTGGACAGCCCTGCTCCTCCAAGGCCCTCCCTCCAACCACACCCTCGGCTACTTGATCACAGGGACTCTGTGGAGCAGGTAGCTGTGCTGGCGTCTTTGGGAATCCTTTCTTTCCTGGGACTGGTGGCTGGGGCCCTGGCACTGGGGCTCTGGCTGAGGCTGAGACGGGGTGGGAAGGATGGATCCCCAAAGCCTGGGTTCTTGGCCTCAGTGATTCCAGTGGACAGGCGTCCAGGAGCTCCAAACCTGTAG |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
Category | Cat No. | Products Name |
---|---|---|
Target Antibody | GM-Tg-g-T47610-Ab | Anti-I11RA/ IL11RA/ CRSDA monoclonal antibody |
Target Antigen | GM-Tg-g-T47610-Ag | IL11RA VLP (virus-like particle) |
Cytokine | cks-Tg-g-GM-T47610 | interleukin 11 receptor, alpha (IL11RA) protein & antibody |
ORF Viral Vector | pGMLP000420 | Human IL11RA Lentivirus plasmid |
ORF Viral Vector | vGMLP000420 | Human IL11RA Lentivirus particle |
Target information
Target ID | GM-T47610 |
Target Name | IL11RA |
Gene ID | 3590, 16157, 700201, 245983, 101085930, 481588, 508932 |
Gene Symbol and Synonyms | CRSDA,GP130,Il-11ra,IL11RA,Il11ra1,Il11ra2,NR1 |
Uniprot Accession | Q14626 |
Uniprot Entry Name | I11RA_HUMAN |
Protein Sub-location | Transmembrane Protein |
Category | Therapeutics Target, Cytokine Target |
Disease | Not Available |
Gene Ensembl | ENSG00000137070 |
Target Classification | Not Available |
Interleukin 11 is a stromal cell-derived cytokine that belongs to a family of pleiotropic and redundant cytokines that use the gp130 transducing subunit in their high affinity receptors. This gene encodes the IL-11 receptor, which is a member of the hematopoietic cytokine receptor family. This particular receptor is very similar to ciliary neurotrophic factor, since both contain an extracellular region with a 2-domain structure composed of an immunoglobulin-like domain and a cytokine receptor-like domain. Multiple alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Jun 2012]
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.