Human CCN1/CCN1/ GIG1 ORF/cDNA clone-Lentivirus plasmid (NM_001554)
Pre-made Human CCN1/CCN1/ GIG1 Lentiviral expression plasmid for CCN1 lentivirus packaging, CCN1 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.
Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.
Go
to CCN1 products collection
>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product information
Catalog No. | Product Name | Plasmid Grade | Plasmid quantity |
---|---|---|---|
pGMLP000491 | Human CCN1 Lentivirus plasmid | Research Grade | 10mg, 50mg, 100mg, 500mg, >1g |
GMP-like Grade | 10mg, 50mg, 100mg, 500mg, >1g | ||
High Quality (HQ) Grade | |||
Seed | 5ug |
Product Description
Catalog ID | pGMLP000491 |
Gene Name | CCN1 |
Accession Number | NM_001554 |
Gene ID | 3491 |
Species | Human |
Product Type | Lentivirus plasmid (overexpression) |
Insert Length | 1146 bp |
Gene Alias | CCN1, GIG1, IGFBP10 |
Fluorescent Reporter | ZsGreen |
Mammalian Cell Selection | Puromyocin |
Fusion Tag | 3xflag (C-Terminal) |
Promoter | CMV |
Resistance | Amplicin |
Sequence | ATGAGCTCCCGCATCGCCAGGGCGCTCGCCTTAGTCGTCACCCTTCTCCACTTGACCAGGCTGGCGCTCTCCACCTGCCCCGCTGCCTGCCACTGCCCCCTGGAGGCGCCCAAGTGCGCGCCGGGAGTCGGGCTGGTCCGGGACGGCTGCGGCTGCTGTAAGGTCTGCGCCAAGCAGCTCAACGAGGACTGCAGCAAAACGCAGCCCTGCGACCACACCAAGGGGCTGGAATGCAACTTCGGCGCCAGCTCCACCGCTCTGAAGGGGATCTGCAGAGCTCAGTCAGAGGGCAGACCCTGTGAATATAACTCCAGAATCTACCAAAACGGGGAAAGTTTCCAGCCCAACTGTAAACATCAGTGCACATGTATTGATGGCGCCGTGGGCTGCATTCCTCTGTGTCCCCAAGAACTATCTCTCCCCAACTTGGGCTGTCCCAACCCTCGGCTGGTCAAAGTTACCGGGCAGTGCTGCGAGGAGTGGGTCTGTGACGAGGATAGTATCAAGGACCCCATGGAGGACCAGGACGGCCTCCTTGGCAAGGAGCTGGGATTCGATGCCTCCGAGGTGGAGTTGACGAGAAACAATGAATTGATTGCAGTTGGAAAAGGCAGCTCACTGAAGCGGCTCCCTGTTTTTGGAATGGAGCCTCGCATCCTATACAACCCTTTACAAGGCCAGAAATGTATTGTTCAAACAACTTCATGGTCCCAGTGCTCAAAGACCTGTGGAACTGGTATCTCCACACGAGTTACCAATGACAACCCTGAGTGCCGCCTTGTGAAAGAAACCCGGATTTGTGAGGTGCGGCCTTGTGGACAGCCAGTGTACAGCAGCCTGAAAAAGGGCAAGAAATGCAGCAAGACCAAGAAATCCCCCGAACCAGTCAGGTTTACTTACGCTGGATGTTTGAGTGTGAAGAAATACCGGCCCAAGTACTGCGGTTCCTGCGTGGACGGCCGATGCTGCACGCCCCAGCTGACCAGGACTGTGAAGATGCGGTTCCGCTGCGAAGATGGGGAGACATTTTCCAAGAACGTCATGATGATCCAGTCCTGCAAATGCAACTACAACTGCCCGCATGCCAATGAAGCAGCGTTTCCCTTCTACAGGCTGTTCAATGACATTCACAAATTTAGGGACTAA |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
Category | Cat No. | Products Name |
---|---|---|
Target Antibody | GM-Tg-g-T56505-Ab | Anti-CCN1/ CYR61/ GIG1 functional antibody |
Target Antigen | GM-Tg-g-T56505-Ag | CCN1 protein |
ORF Viral Vector | pGMAD000547 | Rat Ccn1 Adenovirus plasmid |
ORF Viral Vector | pGMPC001073 | Rat Ccn1 Mammalian (Non-Viral Vector) plasmid |
ORF Viral Vector | pGMLP000491 | Human CCN1 Lentivirus plasmid |
ORF Viral Vector | pGMAP000008 | Human CCN1 Adenovirus plasmid |
ORF Viral Vector | vGMAD000547 | Rat Ccn1 Adenovirus particle |
ORF Viral Vector | vGMLP000491 | Human CCN1 Lentivirus particle |
ORF Viral Vector | vGMAP000008 | Human CCN1 Adenovirus particle |
Target information
Target ID | GM-T56505 |
Target Name | CCN1 |
Gene ID | 3491, 16007, 714970, 83476, 101100068, 479967, 508941, 100064066 |
Gene Symbol and Synonyms | CCN1,CYR61,GIG1,IGFBP10 |
Uniprot Accession | O00622 |
Uniprot Entry Name | CCN1_HUMAN |
Protein Sub-location | Secreted Protein/Potential Cytokines |
Category | Therapeutics Target |
Disease | Cancer |
Gene Ensembl | ENSG00000142871 |
Target Classification | Tumor-associated antigen (TAA) |
The secreted protein encoded by this gene is growth factor-inducible and promotes the adhesion of endothelial cells. The encoded protein interacts with several integrins and with heparan sulfate proteoglycan. This protein also plays a role in cell proliferation, differentiation, angiogenesis, apoptosis, and extracellular matrix formation. [provided by RefSeq, Sep 2011]
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.