Human CDK2/CDKN2/ p33(CDK2) ORF/cDNA clone-Lentivirus plasmid (NM_001798)
Pre-made Human CDK2/CDKN2/ p33(CDK2) Lentiviral expression plasmid for CDK2 lentivirus packaging, CDK2 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.
Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.
Go
to CDK2/CDKN2 products collection
>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product information
Catalog No. | Product Name | Plasmid Grade | Plasmid quantity |
---|---|---|---|
pGMLP000522 | Human CDK2 Lentivirus plasmid | Research Grade | 10mg, 50mg, 100mg, 500mg, >1g |
GMP-like Grade | 10mg, 50mg, 100mg, 500mg, >1g | ||
High Quality (HQ) Grade | |||
Seed | 5ug |
Product Description
Catalog ID | pGMLP000522 |
Gene Name | CDK2 |
Accession Number | NM_001798 |
Gene ID | 1017 |
Species | Human |
Product Type | Lentivirus plasmid (overexpression) |
Insert Length | 897 bp |
Gene Alias | CDKN2, p33(CDK2) |
Fluorescent Reporter | ZsGreen |
Mammalian Cell Selection | Puromyocin |
Fusion Tag | 3xflag (C-Terminal) |
Promoter | CMV |
Resistance | Amplicin |
Sequence | ATGGAGAACTTCCAAAAGGTGGAAAAGATCGGAGAGGGCACGTACGGAGTTGTGTACAAAGCCAGAAACAAGTTGACGGGAGAGGTGGTGGCGCTTAAGAAAATCCGCCTGGACACTGAGACTGAGGGTGTGCCCAGTACTGCCATCCGAGAGATCTCTCTGCTTAAGGAGCTTAACCATCCTAATATTGTCAAGCTGCTGGATGTCATTCACACAGAAAATAAACTCTACCTGGTTTTTGAATTTCTGCACCAAGATCTCAAGAAATTCATGGATGCCTCTGCTCTCACTGGCATTCCTCTTCCCCTCATCAAGAGCTATCTGTTCCAGCTGCTCCAGGGCCTAGCTTTCTGCCATTCTCATCGGGTCCTCCACCGAGACCTTAAACCTCAGAATCTGCTTATTAACACAGAGGGGGCCATCAAGCTAGCAGACTTTGGACTAGCCAGAGCTTTTGGAGTCCCTGTTCGTACTTACACCCATGAGGTGGTGACCCTGTGGTACCGAGCTCCTGAAATCCTCCTGGGCTGCAAATATTATTCCACAGCTGTGGACATCTGGAGCCTGGGCTGCATCTTTGCTGAGATGGTGACTCGCCGGGCCCTATTCCCTGGAGATTCTGAGATTGACCAGCTCTTCCGGATCTTTCGGACTCTGGGGACCCCAGATGAGGTGGTGTGGCCAGGAGTTACTTCTATGCCTGATTACAAGCCAAGTTTCCCCAAGTGGGCCCGGCAAGATTTTAGTAAAGTTGTACCTCCCCTGGATGAAGATGGACGGAGCTTGTTATCGCAAATGCTGCACTACGACCCTAACAAGCGGATTTCGGCCAAGGCAGCCCTGGCTCACCCTTTCTTCCAGGATGTGACCAAGCCAGTACCCCATCTTCGACTCTGA |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
Category | Cat No. | Products Name |
---|---|---|
Target Antibody | GM-Tg-g-T70176-Ab | Anti-CDK2 monoclonal antibody |
Target Antigen | GM-Tg-g-T70176-Ag | CDK2 protein |
ORF Viral Vector | pGMPC001024 | Human CDK2 Mammalian (Non-Viral Vector) plasmid |
ORF Viral Vector | pGMLP000522 | Human CDK2 Lentivirus plasmid |
ORF Viral Vector | pGMAP000235 | Human CDK2 Adenovirus plasmid |
ORF Viral Vector | vGMLP000522 | Human CDK2 Lentivirus particle |
ORF Viral Vector | vGMAP000235 | Human CDK2 Adenovirus particle |
Target information
Target ID | GM-T70176 |
Target Name | CDK2 |
Gene ID | 1017, 12566, 711002, 362817, 101093368, 100855704, 519217, 100051790 |
Gene Symbol and Synonyms | A630093N05Rik,CDK2,CDKN2,p33(CDK2) |
Uniprot Accession | P24941 |
Uniprot Entry Name | CDK2_HUMAN |
Protein Sub-location | Introcelluar Protein |
Category | Therapeutics Target |
Disease | Cancer |
Gene Ensembl | ENSG00000123374 |
Target Classification | Kinase, Tumor-associated antigen (TAA) |
This gene encodes a member of a family of serine/threonine protein kinases that participate in cell cycle regulation. The encoded protein is the catalytic subunit of the cyclin-dependent protein kinase complex, which regulates progression through the cell cycle. Activity of this protein is especially critical during the G1 to S phase transition. This protein associates with and regulated by other subunits of the complex including cyclin A or E, CDK inhibitor p21Cip1 (CDKN1A), and p27Kip1 (CDKN1B). Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2014]
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.