Human IL2/IL-2/ lymphokine ORF/cDNA clone-Lentivirus plasmid (NM_000586)
Pre-made Human IL2/IL-2/ lymphokine Lentiviral expression plasmid for IL2 lentivirus packaging, IL2 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.
Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.
Go
to IL2/IL-2 products collection
>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product information
Catalog No. | Product Name | Plasmid Grade | Plasmid quantity |
---|---|---|---|
pGMLP000542 | Human IL2 Lentivirus plasmid | Research Grade | 10mg, 50mg, 100mg, 500mg, >1g |
GMP-like Grade | 10mg, 50mg, 100mg, 500mg, >1g | ||
High Quality (HQ) Grade | |||
Seed | 5ug |
Product Description
Catalog ID | pGMLP000542 |
Gene Name | IL2 |
Accession Number | NM_000586 |
Gene ID | 3558 |
Species | Human |
Product Type | Lentivirus plasmid (overexpression) |
Insert Length | 462 bp |
Gene Alias | IL-2, lymphokine, TCGF |
Fluorescent Reporter | ZsGreen |
Mammalian Cell Selection | Puromyocin |
Fusion Tag | 3xflag (C-Terminal) |
Promoter | CMV |
Resistance | Amplicin |
Sequence | ATGTACAGGATGCAACTCCTGTCTTGCATTGCACTAAGTCTTGCACTTGTCACAAACAGTGCACCTACTTCAAGTTCTACAAAGAAAACACAGCTACAACTGGAGCATTTACTGCTGGATTTACAGATGATTTTGAATGGAATTAATAATTACAAGAATCCCAAACTCACCAGGATGCTCACATTTAAGTTTTACATGCCCAAGAAGGCCACAGAACTGAAACATCTTCAGTGTCTAGAAGAAGAACTCAAACCTCTGGAGGAAGTGCTAAATTTAGCTCAAAGCAAAAACTTTCACTTAAGACCCAGGGACTTAATCAGCAATATCAACGTAATAGTTCTGGAACTAAAGGGATCTGAAACAACATTCATGTGTGAATATGCTGATGAGACAGCAACCATTGTAGAATTTCTGAACAGATGGATTACCTTTTGTCAAAGCATCATCTCAACACTGACTTGA |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
Category | Cat No. | Products Name |
---|---|---|
Biosimilar | GMP-Bios-INN-811 | Pre-Made Efavaleukin Alfa Biosimilar, Fusion Protein targeting IL2 fused with human IGHG1 Fc (Fragment constant): Recombinant therapeutic protein targeting IL-2/TCGF/lymphokine |
Target Antibody | GM-Tg-g-T61698-Ab | Anti-IL2/ IL-2/ TCGF functional antibody |
Target Antigen | GM-Tg-g-T61698-Ag | IL2 protein |
ORF Viral Vector | pGMLP000542 | Human IL2 Lentivirus plasmid |
ORF Viral Vector | pGMAP000406 | Human IL2 Adenovirus plasmid |
ORF Viral Vector | pGMLP-IL-005 | Human IL2 Lentivirus plasmid |
ORF Viral Vector | pGMAP-IL-088 | Human IL2 Adenovirus plasmid |
ORF Viral Vector | vGMLP000542 | Human IL2 Lentivirus particle |
ORF Viral Vector | vGMAP000406 | Human IL2 Adenovirus particle |
ORF Viral Vector | vGMLP-IL-005 | Human IL2 Lentivirus particle |
ORF Viral Vector | vGMAP-IL-088 | Human IL2 Adenovirus particle |
Target information
Target ID | GM-T61698 |
Target Name | IL2 |
Gene ID | 3558, 16183, 708017, 116562, 751114, 403989, 280822, 100034204 |
Gene Symbol and Synonyms | IL-2,IL2,lymphokine,TCGF |
Uniprot Accession | P60568 |
Uniprot Entry Name | IL2_HUMAN |
Protein Sub-location | Secreted Protein/Potential Cytokines |
Category | Therapeutics Target, Immuno-oncology Target, INN Index |
Disease | Chronic Kidney Disease |
Gene Ensembl | ENSG00000109471 |
Target Classification | Checkpoint-Immuno Oncology |
This gene is a member of the interleukin 2 (IL2) cytokine subfamily which includes IL4, IL7, IL9, IL15, IL21, erythropoietin, and thrombopoietin. The protein encoded by this gene is a secreted cytokine produced by activated CD4+ and CD8+ T lymphocytes, that is important for the proliferation of T and B lymphocytes. The receptor of this cytokine (IL2R) is a heterotrimeric protein complex whose gamma chain is also shared by IL4 and IL7. The expression of this gene in mature thymocytes is monoallelic, which represents an unusual regulatory mode for controlling the precise expression of a single gene. The targeted disruption of a similar gene in mice leads to ulcerative colitis-like disease, which suggests an essential role of this gene in the immune response to antigenic stimuli. [provided by RefSeq, Sep 2020]
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.