Human HFE/HFE1/HH ORF/cDNA clone-Lentivirus plasmid (NM_000410)

Cat. No.: pGMLP000556
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days

Pre-made Human HFE/HFE1/HH Lentiviral expression plasmid for HFE lentivirus packaging, HFE lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.

pdf Datasheet
pdf MSDS
pdf Terms of Use
Target products collection

Go to HFE/HFE1 products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Purchase
Total Price: $593.16
Shipping fee: Limited-time free
For payment issues, contact us.


Product Description

Catalog ID pGMLP000556
Gene Name HFE
Accession Number NM_000410
Gene ID 3077
Species Human
Product Type Lentivirus plasmid (overexpression)
Insert Length 1047 bp
Gene Alias HFE1,HH,HLA-H,MVCD7,TFQTL2
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGGGCCCGCGAGCCAGGCCGGCGCTTCTCCTCCTGATGCTTTTGCAGACCGCGGTCCTGCAGGGGCGCTTGCTGCGTTCACACTCTCTGCACTACCTCTTCATGGGTGCCTCAGAGCAGGACCTTGGTCTTTCCTTGTTTGAAGCTTTGGGCTACGTGGATGACCAGCTGTTCGTGTTCTATGATCATGAGAGTCGCCGTGTGGAGCCCCGAACTCCATGGGTTTCCAGTAGAATTTCAAGCCAGATGTGGCTGCAGCTGAGTCAGAGTCTGAAAGGGTGGGATCACATGTTCACTGTTGACTTCTGGACTATTATGGAAAATCACAACCACAGCAAGGAGTCCCACACCCTGCAGGTCATCCTGGGCTGTGAAATGCAAGAAGACAACAGTACCGAGGGCTACTGGAAGTACGGGTATGATGGGCAGGACCACCTTGAATTCTGCCCTGACACACTGGATTGGAGAGCAGCAGAACCCAGGGCCTGGCCCACCAAGCTGGAGTGGGAAAGGCACAAGATTCGGGCCAGGCAGAACAGGGCCTACCTGGAGAGGGACTGCCCTGCACAGCTGCAGCAGTTGCTGGAGCTGGGGAGAGGTGTTTTGGACCAACAAGTGCCTCCTTTGGTGAAGGTGACACATCATGTGACCTCTTCAGTGACCACTCTACGGTGTCGGGCCTTGAACTACTACCCCCAGAACATCACCATGAAGTGGCTGAAGGATAAGCAGCCAATGGATGCCAAGGAGTTCGAACCTAAAGACGTATTGCCCAATGGGGATGGGACCTACCAGGGCTGGATAACCTTGGCTGTACCCCCTGGGGAAGAGCAGAGATATACGTGCCAGGTGGAGCACCCAGGCCTGGATCAGCCCCTCATTGTGATCTGGGAGCCCTCACCGTCTGGCACCCTAGTCATTGGAGTCATCAGTGGAATTGCTGTTTTTGTCGTCATCTTGTTCATTGGAATTTTGTTCATAATATTAAGGAAGAGGCAGGGTTCAAGAGGAGCCATGGGGCACTACGTCTTAGCTGAACGTGAGTGA
ORF Protein Sequence MGPRARPALLLLMLLQTAVLQGRLLRSHSLHYLFMGASEQDLGLSLFEALGYVDDQLFVFYDHESRRVEPRTPWVSSRISSQMWLQLSQSLKGWDHMFTVDFWTIMENHNHSKESHTLQVILGCEMQEDNSTEGYWKYGYDGQDHLEFCPDTLDWRAAEPRAWPTKLEWERHKIRARQNRAYLERDCPAQLQQLLELGRGVLDQQVPPLVKVTHHVTSSVTTLRCRALNYYPQNITMKWLKDKQPMDAKEFEPKDVLPNGDGTYQGWITLAVPPGEEQRYTCQVEHPGLDQPLIVIWEPSPSGTLVIGVISGIAVFVVILFIGILFIILRKRQGSRGAMGHYVLAERE

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-MP0577-Ab Anti-HFE/ HFE1/ HH monoclonal antibody
    Target Antigen GM-Tg-g-MP0577-Ag HFE VLP (virus-like particle)
    ORF Viral Vector pGMLP000556 Human HFE Lentivirus plasmid
    ORF Viral Vector vGMLP000556 Human HFE Lentivirus particle


    Target information

    Target ID GM-MP0577
    Target Name HFE
    Gene ID 3077, 15216, 696129, 29199, 101084960, 100688951, 497622, 100053350
    Gene Symbol and Synonyms HFE,HFE1,HH,HLA-H,MR2,MVCD7,TFQTL2
    Uniprot Accession Q30201
    Uniprot Entry Name HFE_HUMAN
    Protein Sub-location Transmembrane Protein
    Category Not Available
    Disease Cancer
    Gene Ensembl ENSG00000010704
    Target Classification Tumor-associated antigen (TAA)

    The protein encoded by this gene is a membrane protein that is similar to MHC class I-type proteins and associates with beta2-microglobulin (beta2M). It is thought that this protein functions to regulate iron absorption by regulating the interaction of the transferrin receptor with transferrin. The iron storage disorder, hereditary haemochromatosis, is a recessive genetic disorder that results from defects in this gene. [provided by RefSeq, May 2022]



    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.