Human HFE/HFE1/HH ORF/cDNA clone-Lentivirus plasmid (NM_000410)
Cat. No.: pGMLP000556
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days
Pre-made Human HFE/HFE1/HH Lentiviral expression plasmid for HFE lentivirus packaging, HFE lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.
Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.
Go to
HFE/HFE1 products
collection>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product Description
Catalog ID | pGMLP000556 |
Gene Name | HFE |
Accession Number | NM_000410 |
Gene ID | 3077 |
Species | Human |
Product Type | Lentivirus plasmid (overexpression) |
Insert Length | 1047 bp |
Gene Alias | HFE1,HH,HLA-H,MVCD7,TFQTL2 |
Fluorescent Reporter | ZsGreen |
Mammalian Cell Selection | Puromyocin |
Fusion Tag | 3xflag (C-Terminal) |
Promoter | CMV |
Resistance | Amplicin |
ORF Nucleotide Sequence | ATGGGCCCGCGAGCCAGGCCGGCGCTTCTCCTCCTGATGCTTTTGCAGACCGCGGTCCTGCAGGGGCGCTTGCTGCGTTCACACTCTCTGCACTACCTCTTCATGGGTGCCTCAGAGCAGGACCTTGGTCTTTCCTTGTTTGAAGCTTTGGGCTACGTGGATGACCAGCTGTTCGTGTTCTATGATCATGAGAGTCGCCGTGTGGAGCCCCGAACTCCATGGGTTTCCAGTAGAATTTCAAGCCAGATGTGGCTGCAGCTGAGTCAGAGTCTGAAAGGGTGGGATCACATGTTCACTGTTGACTTCTGGACTATTATGGAAAATCACAACCACAGCAAGGAGTCCCACACCCTGCAGGTCATCCTGGGCTGTGAAATGCAAGAAGACAACAGTACCGAGGGCTACTGGAAGTACGGGTATGATGGGCAGGACCACCTTGAATTCTGCCCTGACACACTGGATTGGAGAGCAGCAGAACCCAGGGCCTGGCCCACCAAGCTGGAGTGGGAAAGGCACAAGATTCGGGCCAGGCAGAACAGGGCCTACCTGGAGAGGGACTGCCCTGCACAGCTGCAGCAGTTGCTGGAGCTGGGGAGAGGTGTTTTGGACCAACAAGTGCCTCCTTTGGTGAAGGTGACACATCATGTGACCTCTTCAGTGACCACTCTACGGTGTCGGGCCTTGAACTACTACCCCCAGAACATCACCATGAAGTGGCTGAAGGATAAGCAGCCAATGGATGCCAAGGAGTTCGAACCTAAAGACGTATTGCCCAATGGGGATGGGACCTACCAGGGCTGGATAACCTTGGCTGTACCCCCTGGGGAAGAGCAGAGATATACGTGCCAGGTGGAGCACCCAGGCCTGGATCAGCCCCTCATTGTGATCTGGGAGCCCTCACCGTCTGGCACCCTAGTCATTGGAGTCATCAGTGGAATTGCTGTTTTTGTCGTCATCTTGTTCATTGGAATTTTGTTCATAATATTAAGGAAGAGGCAGGGTTCAAGAGGAGCCATGGGGCACTACGTCTTAGCTGAACGTGAGTGA |
ORF Protein Sequence | MGPRARPALLLLMLLQTAVLQGRLLRSHSLHYLFMGASEQDLGLSLFEALGYVDDQLFVFYDHESRRVEPRTPWVSSRISSQMWLQLSQSLKGWDHMFTVDFWTIMENHNHSKESHTLQVILGCEMQEDNSTEGYWKYGYDGQDHLEFCPDTLDWRAAEPRAWPTKLEWERHKIRARQNRAYLERDCPAQLQQLLELGRGVLDQQVPPLVKVTHHVTSSVTTLRCRALNYYPQNITMKWLKDKQPMDAKEFEPKDVLPNGDGTYQGWITLAVPPGEEQRYTCQVEHPGLDQPLIVIWEPSPSGTLVIGVISGIAVFVVILFIGILFIILRKRQGSRGAMGHYVLAERE |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
Category | Cat No. | Products Name |
---|---|---|
Target Antibody | GM-Tg-g-MP0577-Ab | Anti-HFE/ HFE1/ HH monoclonal antibody |
Target Antigen | GM-Tg-g-MP0577-Ag | HFE VLP (virus-like particle) |
ORF Viral Vector | pGMLP000556 | Human HFE Lentivirus plasmid |
ORF Viral Vector | vGMLP000556 | Human HFE Lentivirus particle |
Target information
Target ID | GM-MP0577 |
Target Name | HFE |
Gene ID | 3077, 15216, 696129, 29199, 101084960, 100688951, 497622, 100053350 |
Gene Symbol and Synonyms | HFE,HFE1,HH,HLA-H,MR2,MVCD7,TFQTL2 |
Uniprot Accession | Q30201 |
Uniprot Entry Name | HFE_HUMAN |
Protein Sub-location | Transmembrane Protein |
Category | Not Available |
Disease | Cancer |
Gene Ensembl | ENSG00000010704 |
Target Classification | Tumor-associated antigen (TAA) |
The protein encoded by this gene is a membrane protein that is similar to MHC class I-type proteins and associates with beta2-microglobulin (beta2M). It is thought that this protein functions to regulate iron absorption by regulating the interaction of the transferrin receptor with transferrin. The iron storage disorder, hereditary haemochromatosis, is a recessive genetic disorder that results from defects in this gene. [provided by RefSeq, May 2022]
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.