Human IGFBP5/IBP5 ORF/cDNA clone-Lentivirus plasmid (NM_000599)
Pre-made Human IGFBP5/IBP5 Lentiviral expression plasmid for IGFBP5 lentivirus packaging, IGFBP5 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.
Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.
Go
to IGFBP5/IBP5 products collection
>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product information
Catalog No. | Product Name | Plasmid Grade | Plasmid quantity |
---|---|---|---|
pGMLP000569 | Human IGFBP5 Lentivirus plasmid | Research Grade | 10mg, 50mg, 100mg, 500mg, >1g |
GMP-like Grade | 10mg, 50mg, 100mg, 500mg, >1g | ||
High Quality (HQ) Grade | |||
Seed | 5ug |
Product Description
Catalog ID | pGMLP000569 |
Gene Name | IGFBP5 |
Accession Number | NM_000599 |
Gene ID | 3488 |
Species | Human |
Product Type | Lentivirus plasmid (overexpression) |
Insert Length | 819 bp |
Gene Alias | IBP5 |
Fluorescent Reporter | ZsGreen |
Mammalian Cell Selection | Puromyocin |
Fusion Tag | 3xflag (C-Terminal) |
Promoter | CMV |
Resistance | Amplicin |
Sequence | ATGGTGTTGCTCACCGCGGTCCTCCTGCTGCTGGCCGCCTATGCGGGGCCGGCCCAGAGCCTGGGCTCCTTCGTGCACTGCGAGCCCTGCGACGAGAAAGCCCTCTCCATGTGCCCCCCCAGCCCCCTGGGCTGCGAGCTGGTCAAGGAGCCGGGCTGCGGCTGCTGCATGACCTGCGCCCTGGCCGAGGGGCAGTCGTGCGGCGTCTACACCGAGCGCTGCGCCCAGGGGCTGCGCTGCCTCCCCCGGCAGGACGAGGAGAAGCCGCTGCACGCCCTGCTGCACGGCCGCGGGGTTTGCCTCAACGAAAAGAGCTACCGCGAGCAAGTCAAGATCGAGAGAGACTCCCGTGAGCACGAGGAGCCCACCACCTCTGAGATGGCCGAGGAGACCTACTCCCCCAAGATCTTCCGGCCCAAACACACCCGCATCTCCGAGCTGAAGGCTGAAGCAGTGAAGAAGGACCGCAGAAAGAAGCTGACCCAGTCCAAGTTTGTCGGGGGAGCCGAGAACACTGCCCACCCCCGGATCATCTCTGCACCTGAGATGAGACAGGAGTCTGAGCAGGGCCCCTGCCGCAGACACATGGAGGCTTCCCTGCAGGAGCTCAAAGCCAGCCCACGCATGGTGCCCCGTGCTGTGTACCTGCCCAATTGTGACCGCAAAGGATTCTACAAGAGAAAGCAGTGCAAACCTTCCCGTGGCCGCAAGCGTGGCATCTGCTGGTGCGTGGACAAGTACGGGATGAAGCTGCCAGGCATGGAGTACGTTGACGGGGACTTTCAGTGCCACACCTTCGACAGCAGCAACGTTGAGTGA |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
Category | Cat No. | Products Name |
---|---|---|
Target Antibody | GM-Tg-g-SE0987-Ab | Anti-IBP5/ IGFBP5 functional antibody |
Target Antigen | GM-Tg-g-SE0987-Ag | IGFBP5 protein |
Cytokine | cks-Tg-g-GM-SE0987 | insulin-like growth factor binding protein 5 (IGFBP5) protein & antibody |
ORF Viral Vector | pGMAD001087 | Rat Igfbp5 Adenovirus plasmid |
ORF Viral Vector | pGMLP000569 | Human IGFBP5 Lentivirus plasmid |
ORF Viral Vector | vGMAD001087 | Rat Igfbp5 Adenovirus particle |
ORF Viral Vector | vGMLP000569 | Human IGFBP5 Lentivirus particle |
Target information
Target ID | GM-SE0987 |
Target Name | IGFBP5 |
Gene ID | 3488, 16011, 696339, 25285, 101084305, 610316, 404185, 100034063 |
Gene Symbol and Synonyms | IBP5,IGF-BP5,IGFBP-5,IGFBP-5P,IGFBP5 |
Uniprot Accession | P24593 |
Uniprot Entry Name | IBP5_HUMAN |
Protein Sub-location | Secreted Protein/Potential Cytokines |
Category | Cytokine Target |
Disease | Breast Cancer, Dent disease |
Gene Ensembl | ENSG00000115461 |
Target Classification | Not Available |
Enables insulin-like growth factor I binding activity. Involved in several processes, including cellular response to cAMP; regulation of smooth muscle cell migration; and regulation of smooth muscle cell proliferation. Part of insulin-like growth factor ternary complex. Biomarker of pulmonary fibrosis. [provided by Alliance of Genome Resources, Apr 2022]
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.