Human IGFBP5/IBP5 ORF/cDNA clone-Lentivirus particle (NM_000599)

Pre-made Human IGFBP5/IBP5 Lentiviral expression plasmid for IGFBP5 lentivirus packaging, IGFBP5 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.

Target products collectionGo to IGFBP5/IBP5 products collection >>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)



Product information

Catalog No. Product Name lentivirus Grade lentivirus quantity
vGMLP000569 Human IGFBP5 Lentivirus particle Pilot Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
Research Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
GMP-like Grade inquiry
GMP Grade inquiry


Product Description

Catalog ID vGMLP000569
Gene Name IGFBP5
Accession Number NM_000599
Gene ID 3488
Species Human
Product Type Lentivirus particle (overexpression)
Insert Length 819 bp
Gene Alias IBP5
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
Sequence ATGGTGTTGCTCACCGCGGTCCTCCTGCTGCTGGCCGCCTATGCGGGGCCGGCCCAGAGCCTGGGCTCCTTCGTGCACTGCGAGCCCTGCGACGAGAAAGCCCTCTCCATGTGCCCCCCCAGCCCCCTGGGCTGCGAGCTGGTCAAGGAGCCGGGCTGCGGCTGCTGCATGACCTGCGCCCTGGCCGAGGGGCAGTCGTGCGGCGTCTACACCGAGCGCTGCGCCCAGGGGCTGCGCTGCCTCCCCCGGCAGGACGAGGAGAAGCCGCTGCACGCCCTGCTGCACGGCCGCGGGGTTTGCCTCAACGAAAAGAGCTACCGCGAGCAAGTCAAGATCGAGAGAGACTCCCGTGAGCACGAGGAGCCCACCACCTCTGAGATGGCCGAGGAGACCTACTCCCCCAAGATCTTCCGGCCCAAACACACCCGCATCTCCGAGCTGAAGGCTGAAGCAGTGAAGAAGGACCGCAGAAAGAAGCTGACCCAGTCCAAGTTTGTCGGGGGAGCCGAGAACACTGCCCACCCCCGGATCATCTCTGCACCTGAGATGAGACAGGAGTCTGAGCAGGGCCCCTGCCGCAGACACATGGAGGCTTCCCTGCAGGAGCTCAAAGCCAGCCCACGCATGGTGCCCCGTGCTGTGTACCTGCCCAATTGTGACCGCAAAGGATTCTACAAGAGAAAGCAGTGCAAACCTTCCCGTGGCCGCAAGCGTGGCATCTGCTGGTGCGTGGACAAGTACGGGATGAAGCTGCCAGGCATGGAGTACGTTGACGGGGACTTTCAGTGCCACACCTTCGACAGCAGCAACGTTGAGTGA

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-SE0987-Ab Anti-IBP5/ IGFBP5 functional antibody
    Target Antigen GM-Tg-g-SE0987-Ag IGFBP5 protein
    Cytokine cks-Tg-g-GM-SE0987 insulin-like growth factor binding protein 5 (IGFBP5) protein & antibody
    ORF Viral Vector pGMAD001087 Rat Igfbp5 Adenovirus plasmid
    ORF Viral Vector pGMLP000569 Human IGFBP5 Lentivirus plasmid
    ORF Viral Vector vGMAD001087 Rat Igfbp5 Adenovirus particle
    ORF Viral Vector vGMLP000569 Human IGFBP5 Lentivirus particle


    Target information

    Target ID GM-SE0987
    Target Name IGFBP5
    Gene ID 3488, 16011, 696339, 25285, 101084305, 610316, 404185, 100034063
    Gene Symbol and Synonyms IBP5,IGF-BP5,IGFBP-5,IGFBP-5P,IGFBP5
    Uniprot Accession P24593
    Uniprot Entry Name IBP5_HUMAN
    Protein Sub-location Secreted Protein/Potential Cytokines
    Category Cytokine Target
    Disease Breast Cancer, Dent disease
    Gene Ensembl ENSG00000115461
    Target Classification Not Available

    Enables insulin-like growth factor I binding activity. Involved in several processes, including cellular response to cAMP; regulation of smooth muscle cell migration; and regulation of smooth muscle cell proliferation. Part of insulin-like growth factor ternary complex. Biomarker of pulmonary fibrosis. [provided by Alliance of Genome Resources, Apr 2022]



    About GMVC

    GDU



    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.