Human TNFRSF12A/CD266/ FN14 ORF/cDNA clone-Lentivirus plasmid (NM_016639)
Pre-made Human TNFRSF12A/CD266/ FN14 Lentiviral expression plasmid for TNFRSF12A lentivirus packaging, TNFRSF12A lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.
Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.
Go
to TNFRSF12A/CD266 products collection
>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product information
Catalog No. | Product Name | Plasmid Grade | Plasmid quantity |
---|---|---|---|
pGMLP000633 | Human TNFRSF12A Lentivirus plasmid | Research Grade | 10mg, 50mg, 100mg, 500mg, >1g |
GMP-like Grade | 10mg, 50mg, 100mg, 500mg, >1g | ||
High Quality (HQ) Grade | |||
Seed | 5ug |
Product Description
Catalog ID | pGMLP000633 |
Gene Name | TNFRSF12A |
Accession Number | NM_016639 |
Gene ID | 51330 |
Species | Human |
Product Type | Lentivirus plasmid (overexpression) |
Insert Length | 390 bp |
Gene Alias | CD266, FN14, TWEAKR |
Fluorescent Reporter | ZsGreen |
Mammalian Cell Selection | Puromyocin |
Fusion Tag | 3xflag (C-Terminal) |
Promoter | CMV |
Resistance | Amplicin |
Sequence | ATGGCTCGGGGCTCGCTGCGCCGGTTGCTGCGGCTCCTCGTGCTGGGGCTCTGGCTGGCGTTGCTGCGCTCCGTGGCCGGGGAGCAAGCGCCAGGCACCGCCCCCTGCTCCCGCGGCAGCTCCTGGAGCGCGGACCTGGACAAGTGCATGGACTGCGCGTCTTGCAGGGCGCGACCGCACAGCGACTTCTGCCTGGGCTGCGCTGCAGCACCTCCTGCCCCCTTCCGGCTGCTTTGGCCCATCCTTGGGGGCGCTCTGAGCCTGACCTTCGTGCTGGGGCTGCTTTCTGGCTTTTTGGTCTGGAGACGATGCCGCAGGAGAGAGAAGTTCACCACCCCCATAGAGGAGACCGGCGGAGAGGGCTGCCCAGCTGTGGCGCTGATCCAGTGA |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
Category | Cat No. | Products Name |
---|---|---|
Biosimilar | GMP-Bios-ab-180 | Pre-Made Enavatuzumab biosimilar, Whole mAb, Anti-TNFRSF12A Antibody: Anti-CD2664/TWEAKR therapeutic antibody |
Target Antibody | GM-Tg-g-T28717-Ab | Anti-TNR12/ TNFRSF12A/ CD266 monoclonal antibody |
Target Antigen | GM-Tg-g-T28717-Ag | TNFRSF12A VLP (virus-like particle) |
Cytokine | cks-Tg-g-GM-T28717 | Tumor necrosis factor receptor superfamily, member 12A (TNFRSF12A) protein & antibody |
ORF Viral Vector | pGMLV001138 | Human TNFRSF12A Lentivirus plasmid |
ORF Viral Vector | pGMLP000633 | Human TNFRSF12A Lentivirus plasmid |
ORF Viral Vector | vGMLV001138 | Human TNFRSF12A Lentivirus particle |
ORF Viral Vector | vGMLP000633 | Human TNFRSF12A Lentivirus particle |
ORF Viral Vector | pGMLV002476 | Human TNFRSF12A Lentivirus plasmid |
Target information
Target ID | GM-T28717 |
Target Name | TNFRSF12A |
Gene ID | 51330, 27279, 699970, 302965, 101098186, 610734, 617439, 100146755 |
Gene Symbol and Synonyms | CD266,FN14,HPIP,TNFRSF12A,TWEAK-R,TWEAKR |
Uniprot Accession | Q9NP84 |
Uniprot Entry Name | TNR12_HUMAN |
Protein Sub-location | Transmembrane Protein |
Category | Therapeutics Target, Immuno-oncology Target, INN Index, Cytokine Target |
Disease | Not Available |
Gene Ensembl | ENSG00000006327 |
Target Classification | Checkpoint-Immuno Oncology |
Involved in positive regulation of extrinsic apoptotic signaling pathway and regulation of wound healing. Predicted to be located in cell surface and ruffle. Predicted to be active in plasma membrane. [provided by Alliance of Genome Resources, Apr 2022]
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.