Human TNFRSF12A/CD266/ FN14 ORF/cDNA clone-Lentivirus plasmid (NM_016639)

Pre-made Human TNFRSF12A/CD266/ FN14 Lentiviral expression plasmid for TNFRSF12A lentivirus packaging, TNFRSF12A lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.

Target products collectionGo to TNFRSF12A/CD266 products collection >>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)



Product information

Catalog No. Product Name Plasmid Grade Plasmid quantity
pGMLP000633 Human TNFRSF12A Lentivirus plasmid Research Grade 10mg, 50mg, 100mg, 500mg, >1g
GMP-like Grade 10mg, 50mg, 100mg, 500mg, >1g
High Quality (HQ) Grade
Seed 5ug


Product Description

Catalog ID pGMLP000633
Gene Name TNFRSF12A
Accession Number NM_016639
Gene ID 51330
Species Human
Product Type Lentivirus plasmid (overexpression)
Insert Length 390 bp
Gene Alias CD266, FN14, TWEAKR
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
Sequence ATGGCTCGGGGCTCGCTGCGCCGGTTGCTGCGGCTCCTCGTGCTGGGGCTCTGGCTGGCGTTGCTGCGCTCCGTGGCCGGGGAGCAAGCGCCAGGCACCGCCCCCTGCTCCCGCGGCAGCTCCTGGAGCGCGGACCTGGACAAGTGCATGGACTGCGCGTCTTGCAGGGCGCGACCGCACAGCGACTTCTGCCTGGGCTGCGCTGCAGCACCTCCTGCCCCCTTCCGGCTGCTTTGGCCCATCCTTGGGGGCGCTCTGAGCCTGACCTTCGTGCTGGGGCTGCTTTCTGGCTTTTTGGTCTGGAGACGATGCCGCAGGAGAGAGAAGTTCACCACCCCCATAGAGGAGACCGGCGGAGAGGGCTGCCCAGCTGTGGCGCTGATCCAGTGA

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Biosimilar GMP-Bios-ab-180 Pre-Made Enavatuzumab biosimilar, Whole mAb, Anti-TNFRSF12A Antibody: Anti-CD2664/TWEAKR therapeutic antibody
    Target Antibody GM-Tg-g-T28717-Ab Anti-TNR12/ TNFRSF12A/ CD266 monoclonal antibody
    Target Antigen GM-Tg-g-T28717-Ag TNFRSF12A VLP (virus-like particle)
    Cytokine cks-Tg-g-GM-T28717 Tumor necrosis factor receptor superfamily, member 12A (TNFRSF12A) protein & antibody
    ORF Viral Vector pGMLV001138 Human TNFRSF12A Lentivirus plasmid
    ORF Viral Vector pGMLP000633 Human TNFRSF12A Lentivirus plasmid
    ORF Viral Vector vGMLV001138 Human TNFRSF12A Lentivirus particle
    ORF Viral Vector vGMLP000633 Human TNFRSF12A Lentivirus particle
    ORF Viral Vector pGMLV002476 Human TNFRSF12A Lentivirus plasmid


    Target information

    Target ID GM-T28717
    Target Name TNFRSF12A
    Gene ID 51330, 27279, 699970, 302965, 101098186, 610734, 617439, 100146755
    Gene Symbol and Synonyms CD266,FN14,HPIP,TNFRSF12A,TWEAK-R,TWEAKR
    Uniprot Accession Q9NP84
    Uniprot Entry Name TNR12_HUMAN
    Protein Sub-location Transmembrane Protein
    Category Therapeutics Target, Immuno-oncology Target, INN Index, Cytokine Target
    Disease Not Available
    Gene Ensembl ENSG00000006327
    Target Classification Checkpoint-Immuno Oncology

    Involved in positive regulation of extrinsic apoptotic signaling pathway and regulation of wound healing. Predicted to be located in cell surface and ruffle. Predicted to be active in plasma membrane. [provided by Alliance of Genome Resources, Apr 2022]



    About GMVC

    GDU



    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.