Human TAC3/HH10/ NKB ORF/cDNA clone-Lentivirus plasmid (NM_013251.3)
Pre-made Human TAC3/HH10/ NKB Lentiviral expression plasmid for TAC3 lentivirus packaging, TAC3 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.
Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.
Go
to TAC3/HH10 products collection
>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product information
Catalog No. | Product Name | Plasmid Grade | Plasmid quantity |
---|---|---|---|
pGMLP000716 | Human TAC3 Lentivirus plasmid | Research Grade | 10mg, 50mg, 100mg, 500mg, >1g |
GMP-like Grade | 10mg, 50mg, 100mg, 500mg, >1g | ||
High Quality (HQ) Grade | |||
Seed | 5ug |
Product Description
Catalog ID | pGMLP000716 |
Gene Name | TAC3 |
Accession Number | NM_013251.3 |
Gene ID | 6866 |
Species | Human |
Product Type | Lentivirus plasmid (overexpression) |
Insert Length | 366 bp |
Gene Alias | HH10, NKB, NKNB, PRO1155, ZNEUROK1 |
Fluorescent Reporter | ZsGreen |
Mammalian Cell Selection | Puromyocin |
Fusion Tag | 3xflag (C-Terminal) |
Promoter | CMV |
Resistance | Amplicin |
Sequence | ATGAGGATCATGCTGCTATTCACAGCCATCCTGGCCTTCAGCCTAGCTCAGAGCTTTGGGGCTGTCTGTAAGGAGCCACAGGAGGAGGTGGTTCCTGGCGGGGGCCGCAGCAAGAGGGATCCAGATCTCTACCAGCTGCTCCAGAGACTCTTCAAAAGCCACTCATCTCTGGAGGGATTGCTCAAAGCCCTGAGCCAGGCTAGCACAGATCCTAAGGAATCAACATCTCCCGAGAAACGTGACATGCATGACTTCTTTGTGGGACTTATGGGCAAGAGGAGCGTCCAGCCAGACTCTCCTACGGATGTGAATCAAGAGAACGTCCCCAGCTTTGGCATCCTCAAGTATCCCCCGAGAGCAGAATAG |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
Category | Cat No. | Products Name |
---|---|---|
Target Antibody | GM-Tg-g-SE1328-Ab | Anti-TKNK/ TAC3/ HH10 functional antibody |
Target Antigen | GM-Tg-g-SE1328-Ag | TAC3 protein |
ORF Viral Vector | pGMLP000716 | Human TAC3 Lentivirus plasmid |
ORF Viral Vector | vGMLP000716 | Human TAC3 Lentivirus particle |
Target information
Target ID | GM-SE1328 |
Target Name | TAC3 |
Gene ID | 6866, 21334, 713978, 29191, 101089368, 116183080, 281513, 100052673 |
Gene Symbol and Synonyms | HH10,LncZBTB39,LOC116183080,NK3,NKB,NKNB,PPT-B,PRO1155,Tac2,TAC3,ZNEUROK1 |
Uniprot Accession | Q9UHF0 |
Uniprot Entry Name | TKNK_HUMAN |
Protein Sub-location | Secreted Protein/Potential Cytokines |
Category | Not Available |
Disease | Not Available |
Gene Ensembl | ENSG00000166863 |
Target Classification | Not Available |
This gene encodes a member of the tachykinin family of secreted neuropeptides. The encoded preproprotein is proteolytically processed to generate the mature peptide, which is primarily expressed in the central and peripheral nervous systems and functions as a neurotransmitter. This peptide is the ligand for the neurokinin-3 receptor. This protein is also expressed in the outer syncytiotrophoblast of the placenta and may be associated with pregnancy-induced hypertension and pre-eclampsia. Mutations in this gene are associated with normosmic hypogonadotropic hypogonadism. Alternative splicing results in multiple transcript variants, at least one of which encodes an isoform that is proteolytically processed. [provided by RefSeq, Feb 2016]
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.