Human TAC3/HH10/ NKB ORF/cDNA clone-Lentivirus plasmid (NM_013251.3)

Pre-made Human TAC3/HH10/ NKB Lentiviral expression plasmid for TAC3 lentivirus packaging, TAC3 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.

Target products collectionGo to TAC3/HH10 products collection >>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)



Product information

Catalog No. Product Name Plasmid Grade Plasmid quantity
pGMLP000716 Human TAC3 Lentivirus plasmid Research Grade 10mg, 50mg, 100mg, 500mg, >1g
GMP-like Grade 10mg, 50mg, 100mg, 500mg, >1g
High Quality (HQ) Grade
Seed 5ug


Product Description

Catalog ID pGMLP000716
Gene Name TAC3
Accession Number NM_013251.3
Gene ID 6866
Species Human
Product Type Lentivirus plasmid (overexpression)
Insert Length 366 bp
Gene Alias HH10, NKB, NKNB, PRO1155, ZNEUROK1
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
Sequence ATGAGGATCATGCTGCTATTCACAGCCATCCTGGCCTTCAGCCTAGCTCAGAGCTTTGGGGCTGTCTGTAAGGAGCCACAGGAGGAGGTGGTTCCTGGCGGGGGCCGCAGCAAGAGGGATCCAGATCTCTACCAGCTGCTCCAGAGACTCTTCAAAAGCCACTCATCTCTGGAGGGATTGCTCAAAGCCCTGAGCCAGGCTAGCACAGATCCTAAGGAATCAACATCTCCCGAGAAACGTGACATGCATGACTTCTTTGTGGGACTTATGGGCAAGAGGAGCGTCCAGCCAGACTCTCCTACGGATGTGAATCAAGAGAACGTCCCCAGCTTTGGCATCCTCAAGTATCCCCCGAGAGCAGAATAG

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-SE1328-Ab Anti-TKNK/ TAC3/ HH10 functional antibody
    Target Antigen GM-Tg-g-SE1328-Ag TAC3 protein
    ORF Viral Vector pGMLP000716 Human TAC3 Lentivirus plasmid
    ORF Viral Vector vGMLP000716 Human TAC3 Lentivirus particle


    Target information

    Target ID GM-SE1328
    Target Name TAC3
    Gene ID 6866, 21334, 713978, 29191, 101089368, 116183080, 281513, 100052673
    Gene Symbol and Synonyms HH10,LncZBTB39,LOC116183080,NK3,NKB,NKNB,PPT-B,PRO1155,Tac2,TAC3,ZNEUROK1
    Uniprot Accession Q9UHF0
    Uniprot Entry Name TKNK_HUMAN
    Protein Sub-location Secreted Protein/Potential Cytokines
    Category Not Available
    Disease Not Available
    Gene Ensembl ENSG00000166863
    Target Classification Not Available

    This gene encodes a member of the tachykinin family of secreted neuropeptides. The encoded preproprotein is proteolytically processed to generate the mature peptide, which is primarily expressed in the central and peripheral nervous systems and functions as a neurotransmitter. This peptide is the ligand for the neurokinin-3 receptor. This protein is also expressed in the outer syncytiotrophoblast of the placenta and may be associated with pregnancy-induced hypertension and pre-eclampsia. Mutations in this gene are associated with normosmic hypogonadotropic hypogonadism. Alternative splicing results in multiple transcript variants, at least one of which encodes an isoform that is proteolytically processed. [provided by RefSeq, Feb 2016]



    About GMVC

    GDU



    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.