Human GNRH2/GnRH-II/LH-RHII ORF/cDNA clone-Lentivirus plasmid (NM_001501)

Cat. No.: pGMLP000745
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days

Pre-made Human GNRH2/GnRH-II/LH-RHII Lentiviral expression plasmid for GNRH2 lentivirus packaging, GNRH2 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.


Target products collection

Go to GNRH2/GnRH-II products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Purchase
Total Price: $450
Shipping fee: Limited-time free
For payment issues, contact us.


Product Description

Catalog ID pGMLP000745
Gene Name GNRH2
Accession Number NM_001501
Gene ID 2797
Species Human
Product Type Lentivirus plasmid (overexpression)
Insert Length 363 bp
Gene Alias GnRH-II,LH-RHII
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGGCCAGCTCCAGGCGAGGCCTCCTGCTCCTGCTGCTGCTGACTGCCCACCTTGGACCCTCAGAGGCTCAGCACTGGTCCCATGGCTGGTACCCTGGAGGAAAGCGAGCCCTCAGCTCAGCCCAGGATCCCCAGAATGCCCTTAGGCCCCCAGGAAGGGCCCTGGACACTGCAGCAGGCAGCCCAGTCCAGACTGCCCATGGCCTCCCAAGTGATGCCCTGGCTCCCCTGGACGACAGCATGCCCTGGGAGGGCAGGACCACGGCCCAGTGGTCCCTTCACAGGAAGCGACACCTGGCACGGACACTGCTGACCGCAGCCCGAGAGCCCCGCCCCGCCCCGCCATCCTCCAATAAAGTGTGA
ORF Protein Sequence MASSRRGLLLLLLLTAHLGPSEAQHWSHGWYPGGKRALSSAQDPQNALRPPGRALDTAAGSPVQTAHGLPSDALAPLDDSMPWEGRTTAQWSLHRKRHLARTLLTAAREPRPAPPSSNKV

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-SE0951-Ab Anti-GON2/ GNRH2/ GnRH-II functional antibody
    Target Antigen GM-Tg-g-SE0951-Ag GNRH2 protein
    ORF Viral Vector pGMLP000745 Human GNRH2 Lentivirus plasmid
    ORF Viral Vector vGMLP000745 Human GNRH2 Lentivirus particle


    Target information

    Target ID GM-SE0951
    Target Name GNRH2
    Gene ID 2797, 619516, 102901429, 100848664, 102149638
    Gene Symbol and Synonyms Gn-RHII,GnRH-II,GNRH2,GnRHII,LH-RHII,LOC102901429
    Uniprot Accession O43555
    Uniprot Entry Name GON2_HUMAN
    Protein Sub-location Secreted Protein/Potential Cytokines
    Category Not Available
    Disease Not Available
    Gene Ensembl ENSG00000125787
    Target Classification Not Available

    This gene is a member of the gonadotropin-releasing hormone (GnRH) gene family. Proteins encoded by members of this gene family are proteolytically cleaved to form neuropeptides which, in part, regulate reproductive functions by stimulating the production and release of the gonadotropins follicle-stimulating hormone (FSH) and luteinizing hormone (LH). The human GNRH2 gene is predicted to encode a preproprotein from which a mature neuropeptide of 10 amino acids is cleaved. However, while the human genome retains the sequence for a functional GNRH2 decapeptide, translation of the human GNRH2 gene has not yet been demonstrated and the GNRH2 gene of chimpanzees, gorilla, and Sumatran orangutan have a premature stop at codon eight of the decapeptide sequence which suggests GNRH2 was a pseudogene in the hominid lineage. The GNRH2 gene is also believed to be a pseudogene in many other mammalian species such as mouse and cow. The receptor for this gene (GNRHR2) is predicted to be a pseudogene in human as well as many other mammalian species. The closely related GNRH1 and GNRHR1 genes are functional in human and other mammals and are generally functional in vertebrates. [provided by RefSeq, Mar 2019]



    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.