Human GNRH2/GnRH-II/LH-RHII ORF/cDNA clone-Lentivirus particle (NM_001501)
Cat. No.: vGMLP000745
Pre-made Human GNRH2/GnRH-II/LH-RHII Lentiviral expression plasmid for GNRH2 lentivirus packaging, GNRH2 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.
The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.
Go to
GNRH2/GnRH-II products
collection>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Catalog No. | Product Name | lentivirus Grade | lentivirus quantity |
---|---|---|---|
vGMLP000745 | Human GNRH2 Lentivirus particle | Pilot Grade | 1.0E+8TU |
5.0E+8TU | |||
1.0E+9TU | |||
Research Grade | 1.0E+8TU | ||
5.0E+8TU | |||
1.0E+9TU | |||
GMP-like Grade | inquiry | ||
GMP Grade | inquiry |
Product Description
Catalog ID | vGMLP000745 |
Gene Name | GNRH2 |
Accession Number | NM_001501 |
Gene ID | 2797 |
Species | Human |
Product Type | Lentivirus particle (overexpression) |
Insert Length | 363 bp |
Gene Alias | GnRH-II,LH-RHII |
Fluorescent Reporter | ZsGreen |
Mammalian Cell Selection | Puromyocin |
Fusion Tag | 3xflag (C-Terminal) |
Promoter | CMV |
Resistance | Amplicin |
ORF Nucleotide Sequence | ATGGCCAGCTCCAGGCGAGGCCTCCTGCTCCTGCTGCTGCTGACTGCCCACCTTGGACCCTCAGAGGCTCAGCACTGGTCCCATGGCTGGTACCCTGGAGGAAAGCGAGCCCTCAGCTCAGCCCAGGATCCCCAGAATGCCCTTAGGCCCCCAGGAAGGGCCCTGGACACTGCAGCAGGCAGCCCAGTCCAGACTGCCCATGGCCTCCCAAGTGATGCCCTGGCTCCCCTGGACGACAGCATGCCCTGGGAGGGCAGGACCACGGCCCAGTGGTCCCTTCACAGGAAGCGACACCTGGCACGGACACTGCTGACCGCAGCCCGAGAGCCCCGCCCCGCCCCGCCATCCTCCAATAAAGTGTGA |
ORF Protein Sequence | MASSRRGLLLLLLLTAHLGPSEAQHWSHGWYPGGKRALSSAQDPQNALRPPGRALDTAAGSPVQTAHGLPSDALAPLDDSMPWEGRTTAQWSLHRKRHLARTLLTAAREPRPAPPSSNKV |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
Category | Cat No. | Products Name |
---|---|---|
Target Antibody | GM-Tg-g-SE0951-Ab | Anti-GON2/ GNRH2/ GnRH-II functional antibody |
Target Antigen | GM-Tg-g-SE0951-Ag | GNRH2 protein |
ORF Viral Vector | pGMLP000745 | Human GNRH2 Lentivirus plasmid |
ORF Viral Vector | vGMLP000745 | Human GNRH2 Lentivirus particle |
Target information
Target ID | GM-SE0951 |
Target Name | GNRH2 |
Gene ID | 2797, 619516, 102901429, 100848664, 102149638 |
Gene Symbol and Synonyms | Gn-RHII,GnRH-II,GNRH2,GnRHII,LH-RHII,LOC102901429 |
Uniprot Accession | O43555 |
Uniprot Entry Name | GON2_HUMAN |
Protein Sub-location | Secreted Protein/Potential Cytokines |
Category | Not Available |
Disease | Not Available |
Gene Ensembl | ENSG00000125787 |
Target Classification | Not Available |
This gene is a member of the gonadotropin-releasing hormone (GnRH) gene family. Proteins encoded by members of this gene family are proteolytically cleaved to form neuropeptides which, in part, regulate reproductive functions by stimulating the production and release of the gonadotropins follicle-stimulating hormone (FSH) and luteinizing hormone (LH). The human GNRH2 gene is predicted to encode a preproprotein from which a mature neuropeptide of 10 amino acids is cleaved. However, while the human genome retains the sequence for a functional GNRH2 decapeptide, translation of the human GNRH2 gene has not yet been demonstrated and the GNRH2 gene of chimpanzees, gorilla, and Sumatran orangutan have a premature stop at codon eight of the decapeptide sequence which suggests GNRH2 was a pseudogene in the hominid lineage. The GNRH2 gene is also believed to be a pseudogene in many other mammalian species such as mouse and cow. The receptor for this gene (GNRHR2) is predicted to be a pseudogene in human as well as many other mammalian species. The closely related GNRH1 and GNRHR1 genes are functional in human and other mammals and are generally functional in vertebrates. [provided by RefSeq, Mar 2019]
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.