Human VEGFB/VEGFL/ VRF ORF/cDNA clone-Lentivirus plasmid (NM_003377)
Pre-made Human VEGFB/VEGFL/ VRF Lentiviral expression plasmid for VEGFB lentivirus packaging, VEGFB lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.
Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.
Go
to VEGFB/VEGFL products collection
>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product information
Catalog No. | Product Name | Plasmid Grade | Plasmid quantity |
---|---|---|---|
pGMLP000756 | Human VEGFB Lentivirus plasmid | Research Grade | 10mg, 50mg, 100mg, 500mg, >1g |
GMP-like Grade | 10mg, 50mg, 100mg, 500mg, >1g | ||
High Quality (HQ) Grade | |||
Seed | 5ug |
Product Description
Catalog ID | pGMLP000756 |
Gene Name | VEGFB |
Accession Number | NM_003377 |
Gene ID | 7423 |
Species | Human |
Product Type | Lentivirus plasmid (overexpression) |
Insert Length | 624 bp |
Gene Alias | VEGFL, VRF |
Fluorescent Reporter | ZsGreen |
Mammalian Cell Selection | Puromyocin |
Fusion Tag | 3xflag (C-Terminal) |
Promoter | CMV |
Resistance | Amplicin |
Sequence | ATGAGCCCTCTGCTCCGCCGCCTGCTGCTCGCCGCACTCCTGCAGCTGGCCCCCGCCCAGGCCCCTGTCTCCCAGCCTGATGCCCCTGGCCACCAGAGGAAAGTGGTGTCATGGATAGATGTGTATACTCGCGCTACCTGCCAGCCCCGGGAGGTGGTGGTGCCCTTGACTGTGGAGCTCATGGGCACCGTGGCCAAACAGCTGGTGCCCAGCTGCGTGACTGTGCAGCGCTGTGGTGGCTGCTGCCCTGACGATGGCCTGGAGTGTGTGCCCACTGGGCAGCACCAAGTCCGGATGCAGATCCTCATGATCCGGTACCCGAGCAGTCAGCTGGGGGAGATGTCCCTGGAAGAACACAGCCAGTGTGAATGCAGACCTAAAAAAAAGGACAGTGCTGTGAAGCCAGACAGGGCTGCCACTCCCCACCACCGTCCCCAGCCCCGTTCTGTTCCGGGCTGGGACTCTGCCCCCGGAGCACCCTCCCCAGCTGACATCACCCATCCCACTCCAGCCCCAGGCCCCTCTGCCCACGCTGCACCCAGCACCACCAGCGCCCTGACCCCCGGACCTGCCGCTGCCGCTGCCGACGCCGCAGCTTCCTCCGTTGCCAAGGGCGGGGCTTAG |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
Category | Cat No. | Products Name |
---|---|---|
Target Antibody | GM-Tg-g-T30040-Ab | Anti-VEGFB/ VEGFL/ VRF functional antibody |
Target Antigen | GM-Tg-g-T30040-Ag | VEGFB protein |
Cytokine | cks-Tg-g-GM-T30040 | Vascular endothelial growth factor B (VEGFB) protein & antibody |
ORF Viral Vector | pGMLP000756 | Human VEGFB Lentivirus plasmid |
ORF Viral Vector | vGMLP000756 | Human VEGFB Lentivirus particle |
Target information
Target ID | GM-T30040 |
Target Name | VEGFB |
Gene ID | 7423, 22340, 722115, 89811, 101092465, 476036, 282121, 100055238 |
Gene Symbol and Synonyms | VEGF-B,VEGFB,VEGFL,VRF |
Uniprot Accession | P49765 |
Uniprot Entry Name | VEGFB_HUMAN |
Protein Sub-location | Secreted Protein/Potential Cytokines |
Category | Therapeutics Target, Cytokine Target |
Disease | Cancer |
Gene Ensembl | ENSG00000173511 |
Target Classification | Tumor-associated antigen (TAA) |
This gene encodes a member of the PDGF (platelet-derived growth factor)/VEGF (vascular endothelial growth factor) family. The VEGF family members regulate the formation of blood vessels and are involved in endothelial cell physiology. This member is a ligand for VEGFR-1 (vascular endothelial growth factor receptor 1) and NRP-1 (neuropilin-1). Studies in mice showed that this gene was co-expressed with nuclear-encoded mitochondrial genes and the encoded protein specifically controlled endothelial uptake of fatty acids. Alternatively spliced transcript variants encoding distinct isoforms have been identified. [provided by RefSeq, Sep 2011]
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.