Human GABRR2 ORF/cDNA clone-Lentivirus plasmid (NM_002043)

Cat. No.: pGMLP000759
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days

Pre-made Human GABRR2/ Lentiviral expression plasmid for GABRR2 lentivirus packaging, GABRR2 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.


Target products collection

Go to GABRR2/ products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Purchase
Total Price: $691.44
Shipping fee: Limited-time free
For payment issues, contact us.


Product Description

Catalog ID pGMLP000759
Gene Name GABRR2
Accession Number NM_002043
Gene ID 2570
Species Human
Product Type Lentivirus plasmid (overexpression)
Insert Length 1398 bp
Gene Alias
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGCCTTATTTTACAAGACTCATTTTGTTCTTGTTTTGCTTGATGGTTCTCGTGGAGAGCAGAAAACCCAAGAGGAAGCGATGGACAGGGCAGGTGGAAATGCCCAAGCCAAGTCACTTATATAAGAAGAACCTTGATGTGACCAAGATCCGGAAGGGAAAGCCTCAGCAGCTTCTCAGAGTGGACGAGCACGACTTCAGCATGAGACCCGCCTTCGGAGGCCCTGCCATCCCGGTGGGCGTGGACGTACAGGTGGAGAGCCTGGACAGCATCTCCGAGGTGGACATGGACTTCACTATGACCCTGTACCTGCGGCATTACTGGAAGGATGAGAGGCTAGCTTTCTCCAGCGCCAGCAACAAGAGCATGACCTTCGATGGCCGGCTGGTGAAGAAGATCTGGGTCCCTGATGTCTTCTTTGTTCACTCCAAAAGATCGTTCACTCATGACACCACCACTGACAACATCATGCTGAGGGTGTTCCCAGATGGACACGTGCTGTACAGCATGAGGATTACGGTCACTGCCATGTGCAACATGGACTTCAGCCACTTTCCCCTGGACTCCCAGACCTGTTCTTTGGAGCTGGAGAGCTATGCCTATACAGATGAAGATCTAATGCTGTACTGGAAGAATGGGGATGAATCCCTAAAAACAGATGAGAAGATCTCCTTGTCTCAGTTTCTGATTCAGAAATTTCACACAACTTCCAGGCTGGCCTTCTACAGCAGCACTGGCTGGTACAACCGTCTGTACATTAACTTCACGTTGCGTCGCCACATCTTCTTCTTCTTGCTCCAAACATATTTCCCTGCCACTCTGATGGTCATGCTGTCCTGGGTGTCCTTCTGGATCGACCGCAGAGCTGTGCCTGCCAGAGTTTCACTGGGTATCACGACGGTGCTGACCATGACCACCATCATCACGGGCGTGAATGCCTCCATGCCGCGCGTCTCCTACGTCAAGGCCGTGGACATCTACCTCTGGGTCAGCTTTGTGTTCGTGTTCCTCTCGGTGCTGGAGTATGCGGCTGTCAACTACCTGACCACCGTGCAGGAGCGCAAGGAACGGAAGCTGCGGGAGAAGTTCCCGTGCATGTGTGGAATGCTTCATTCAAAAACCATGATGCTGGATGGAAGCTACAGTGAGTCTGAGGCCAACAGCCTGGCTGGGTACCCCAGAAGCCATATCCTGACAGAAGAAGAAAGGCAAGACAAAATAGTGGTCCACCTGGGCCTGAGTGGTGAAGCCAACGCTGCCAGAAAGAAGGGGCTTCTGAAGGGCCAGACGGGTTTTCGTATCTTCCAGAATACCCATGCCATTGACAAATACTCTAGGTTGATATTCCCTGCCTCCTACATATTTTTCAACTTAATTTATTGGTCAGTGTTTTCCTAG
ORF Protein Sequence MPYFTRLILFLFCLMVLVESRKPKRKRWTGQVEMPKPSHLYKKNLDVTKIRKGKPQQLLRVDEHDFSMRPAFGGPAIPVGVDVQVESLDSISEVDMDFTMTLYLRHYWKDERLAFSSASNKSMTFDGRLVKKIWVPDVFFVHSKRSFTHDTTTDNIMLRVFPDGHVLYSMRITVTAMCNMDFSHFPLDSQTCSLELESYAYTDEDLMLYWKNGDESLKTDEKISLSQFLIQKFHTTSRLAFYSSTGWYNRLYINFTLRRHIFFFLLQTYFPATLMVMLSWVSFWIDRRAVPARVSLGITTVLTMTTIITGVNASMPRVSYVKAVDIYLWVSFVFVFLSVLEYAAVNYLTTVQERKERKLREKFPCMCGMLHSKTMMLDGSYSESEANSLAGYPRSHILTEEERQDKIVVHLGLSGEANAARKKGLLKGQTGFRIFQNTHAIDKYSRLIFPASYIFFNLIYWSVFS

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-T90682-Ab Anti-GBRR2/ GABRR2 monoclonal antibody
    Target Antigen GM-Tg-g-T90682-Ag GABRR2 VLP (virus-like particle)
    ORF Viral Vector pGMLP000759 Human GABRR2 Lentivirus plasmid
    ORF Viral Vector vGMLP000759 Human GABRR2 Lentivirus particle


    Target information

    Target ID GM-T90682
    Target Name GABRR2
    Gene ID 2570, 14409, 700858, 29695, 481918, 522099, 100070995
    Gene Symbol and Synonyms GABRR2
    Uniprot Accession P28476
    Uniprot Entry Name GBRR2_HUMAN
    Protein Sub-location Transmembrane Protein
    Category Therapeutics Target
    Disease Not Available
    Gene Ensembl ENSG00000111886
    Target Classification Not Available

    Gamma-aminobutyric acid (GABA) is the major inhibitory neurotransmitter in the mammalian brain where it acts at GABA receptors, which are ligand-gated chloride channels. The protein encoded by this gene is a member of the rho subunit family and is a component of the GABA type A receptor complex. This gene exists on chromosome 6q next to the gene encoding the rho 1 subunit of the GABA type A receptor, in a region thought to be associated with susceptibility for psychiatric disorders and epilepsy. Polymorphisms in this gene may also be associated with alcohol dependence, and general cognitive ability.



    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.