Human GABRR2 ORF/cDNA clone-Lentivirus plasmid (NM_002043)
Cat. No.: pGMLP000759
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days
Pre-made Human GABRR2/ Lentiviral expression plasmid for GABRR2 lentivirus packaging, GABRR2 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.
Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.
Go to
GABRR2/ products
collection>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product Description
Catalog ID | pGMLP000759 |
Gene Name | GABRR2 |
Accession Number | NM_002043 |
Gene ID | 2570 |
Species | Human |
Product Type | Lentivirus plasmid (overexpression) |
Insert Length | 1398 bp |
Gene Alias | |
Fluorescent Reporter | ZsGreen |
Mammalian Cell Selection | Puromyocin |
Fusion Tag | 3xflag (C-Terminal) |
Promoter | CMV |
Resistance | Amplicin |
ORF Nucleotide Sequence | ATGCCTTATTTTACAAGACTCATTTTGTTCTTGTTTTGCTTGATGGTTCTCGTGGAGAGCAGAAAACCCAAGAGGAAGCGATGGACAGGGCAGGTGGAAATGCCCAAGCCAAGTCACTTATATAAGAAGAACCTTGATGTGACCAAGATCCGGAAGGGAAAGCCTCAGCAGCTTCTCAGAGTGGACGAGCACGACTTCAGCATGAGACCCGCCTTCGGAGGCCCTGCCATCCCGGTGGGCGTGGACGTACAGGTGGAGAGCCTGGACAGCATCTCCGAGGTGGACATGGACTTCACTATGACCCTGTACCTGCGGCATTACTGGAAGGATGAGAGGCTAGCTTTCTCCAGCGCCAGCAACAAGAGCATGACCTTCGATGGCCGGCTGGTGAAGAAGATCTGGGTCCCTGATGTCTTCTTTGTTCACTCCAAAAGATCGTTCACTCATGACACCACCACTGACAACATCATGCTGAGGGTGTTCCCAGATGGACACGTGCTGTACAGCATGAGGATTACGGTCACTGCCATGTGCAACATGGACTTCAGCCACTTTCCCCTGGACTCCCAGACCTGTTCTTTGGAGCTGGAGAGCTATGCCTATACAGATGAAGATCTAATGCTGTACTGGAAGAATGGGGATGAATCCCTAAAAACAGATGAGAAGATCTCCTTGTCTCAGTTTCTGATTCAGAAATTTCACACAACTTCCAGGCTGGCCTTCTACAGCAGCACTGGCTGGTACAACCGTCTGTACATTAACTTCACGTTGCGTCGCCACATCTTCTTCTTCTTGCTCCAAACATATTTCCCTGCCACTCTGATGGTCATGCTGTCCTGGGTGTCCTTCTGGATCGACCGCAGAGCTGTGCCTGCCAGAGTTTCACTGGGTATCACGACGGTGCTGACCATGACCACCATCATCACGGGCGTGAATGCCTCCATGCCGCGCGTCTCCTACGTCAAGGCCGTGGACATCTACCTCTGGGTCAGCTTTGTGTTCGTGTTCCTCTCGGTGCTGGAGTATGCGGCTGTCAACTACCTGACCACCGTGCAGGAGCGCAAGGAACGGAAGCTGCGGGAGAAGTTCCCGTGCATGTGTGGAATGCTTCATTCAAAAACCATGATGCTGGATGGAAGCTACAGTGAGTCTGAGGCCAACAGCCTGGCTGGGTACCCCAGAAGCCATATCCTGACAGAAGAAGAAAGGCAAGACAAAATAGTGGTCCACCTGGGCCTGAGTGGTGAAGCCAACGCTGCCAGAAAGAAGGGGCTTCTGAAGGGCCAGACGGGTTTTCGTATCTTCCAGAATACCCATGCCATTGACAAATACTCTAGGTTGATATTCCCTGCCTCCTACATATTTTTCAACTTAATTTATTGGTCAGTGTTTTCCTAG |
ORF Protein Sequence | MPYFTRLILFLFCLMVLVESRKPKRKRWTGQVEMPKPSHLYKKNLDVTKIRKGKPQQLLRVDEHDFSMRPAFGGPAIPVGVDVQVESLDSISEVDMDFTMTLYLRHYWKDERLAFSSASNKSMTFDGRLVKKIWVPDVFFVHSKRSFTHDTTTDNIMLRVFPDGHVLYSMRITVTAMCNMDFSHFPLDSQTCSLELESYAYTDEDLMLYWKNGDESLKTDEKISLSQFLIQKFHTTSRLAFYSSTGWYNRLYINFTLRRHIFFFLLQTYFPATLMVMLSWVSFWIDRRAVPARVSLGITTVLTMTTIITGVNASMPRVSYVKAVDIYLWVSFVFVFLSVLEYAAVNYLTTVQERKERKLREKFPCMCGMLHSKTMMLDGSYSESEANSLAGYPRSHILTEEERQDKIVVHLGLSGEANAARKKGLLKGQTGFRIFQNTHAIDKYSRLIFPASYIFFNLIYWSVFS |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
Category | Cat No. | Products Name |
---|---|---|
Target Antibody | GM-Tg-g-T90682-Ab | Anti-GBRR2/ GABRR2 monoclonal antibody |
Target Antigen | GM-Tg-g-T90682-Ag | GABRR2 VLP (virus-like particle) |
ORF Viral Vector | pGMLP000759 | Human GABRR2 Lentivirus plasmid |
ORF Viral Vector | vGMLP000759 | Human GABRR2 Lentivirus particle |
Target information
Target ID | GM-T90682 |
Target Name | GABRR2 |
Gene ID | 2570, 14409, 700858, 29695, 481918, 522099, 100070995 |
Gene Symbol and Synonyms | GABRR2 |
Uniprot Accession | P28476 |
Uniprot Entry Name | GBRR2_HUMAN |
Protein Sub-location | Transmembrane Protein |
Category | Therapeutics Target |
Disease | Not Available |
Gene Ensembl | ENSG00000111886 |
Target Classification | Not Available |
Gamma-aminobutyric acid (GABA) is the major inhibitory neurotransmitter in the mammalian brain where it acts at GABA receptors, which are ligand-gated chloride channels. The protein encoded by this gene is a member of the rho subunit family and is a component of the GABA type A receptor complex. This gene exists on chromosome 6q next to the gene encoding the rho 1 subunit of the GABA type A receptor, in a region thought to be associated with susceptibility for psychiatric disorders and epilepsy. Polymorphisms in this gene may also be associated with alcohol dependence, and general cognitive ability.
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.