Human SSTR4/SS-4-R/SS4-R ORF/cDNA clone-Lentivirus plasmid (NM_001052)

Cat. No.: pGMLP000761
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days

Pre-made Human SSTR4/SS-4-R/SS4-R Lentiviral expression plasmid for SSTR4 lentivirus packaging, SSTR4 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.

pdf Datasheet
pdf MSDS
pdf Terms of Use
Target products collection

Go to SSTR4/SS-4-R products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Purchase
Total Price: $626.76
Shipping fee: Limited-time free
For payment issues, contact us.


Product Description

Catalog ID pGMLP000761
Gene Name SSTR4
Accession Number NM_001052
Gene ID 6754
Species Human
Product Type Lentivirus plasmid (overexpression)
Insert Length 1167 bp
Gene Alias SS-4-R,SS4-R,SS4R
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGAGCGCCCCCTCGACGCTGCCCCCCGGGGGCGAGGAAGGGCTGGGGACGGCCTGGCCCTCTGCAGCCAATGCCAGTAGCGCTCCGGCGGAGGCGGAGGAGGCGGTGGCGGGGCCCGGGGACGCGCGGGCGGCGGGCATGGTCGCTATCCAGTGCATCTACGCGCTGGTGTGCCTGGTGGGGCTGGTGGGCAACGCCCTGGTCATCTTCGTGATCCTTCGCTACGCCAAGATGAAGACGGCTACCAACATCTACCTGCTCAACCTGGCCGTAGCCGACGAGCTCTTCATGCTGAGCGTGCCCTTCGTGGCCTCGTCGGCCGCCCTGCGCCACTGGCCCTTCGGCTCCGTGCTGTGCCGCGCGGTGCTCAGCGTCGACGGCCTCAACATGTTCACCAGCGTCTTCTGTCTCACCGTGCTCAGCGTGGACCGCTACGTGGCCGTGGTGCACCCTCTGCGCGCGGCGACCTACCGGCGGCCCAGCGTGGCCAAGCTCATCAACCTGGGCGTGTGGCTGGCATCCCTGTTGGTCACTCTCCCCATCGCCATCTTCGCAGACACCAGACCGGCTCGCGGCGGCCAGGCCGTGGCCTGCAACCTGCAGTGGCCACACCCGGCCTGGTCGGCAGTCTTCGTGGTCTACACTTTCCTGCTGGGCTTCCTGCTGCCCGTGCTGGCCATTGGCCTGTGCTACCTGCTCATCGTGGGCAAGATGCGCGCCGTGGCCCTGCGCGCTGGCTGGCAGCAGCGCAGGCGCTCGGAGAAGAAAATCACCAGGCTGGTGCTGATGGTCGTGGTCGTCTTTGTGCTCTGCTGGATGCCTTTCTACGTGGTGCAGCTGCTGAACCTCTTCGTGACCAGCCTTGATGCCACCGTCAACCACGTGTCCCTTATCCTTAGCTATGCCAACAGCTGCGCCAACCCCATTCTCTATGGCTTCCTCTCCGACAACTTCCGCCGATTCTTCCAGCGGGTTCTCTGCCTGCGCTGCTGCCTCCTGGAAGGTGCTGGAGGTGCTGAGGAGGAGCCCCTGGACTACTATGCCACTGCTCTCAAGAGCAAAGGTGGGGCAGGGTGCATGTGCCCCCCACTCCCCTGCCAGCAGGAAGCCCTGCAACCAGAACCCGGCCGCAAGCGCATCCCCCTCACCAGGACCACCACCTTCTGA
ORF Protein Sequence MSAPSTLPPGGEEGLGTAWPSAANASSAPAEAEEAVAGPGDARAAGMVAIQCIYALVCLVGLVGNALVIFVILRYAKMKTATNIYLLNLAVADELFMLSVPFVASSAALRHWPFGSVLCRAVLSVDGLNMFTSVFCLTVLSVDRYVAVVHPLRAATYRRPSVAKLINLGVWLASLLVTLPIAIFADTRPARGGQAVACNLQWPHPAWSAVFVVYTFLLGFLLPVLAIGLCYLLIVGKMRAVALRAGWQQRRRSEKKITRLVLMVVVVFVLCWMPFYVVQLLNLFVTSLDATVNHVSLILSYANSCANPILYGFLSDNFRRFFQRVLCLRCCLLEGAGGAEEEPLDYYATALKSKGGAGCMCPPLPCQQEALQPEPGRKRIPLTRTTTF

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-MP1710-Ab Anti-SSR4/ SSTR4/ SS-4-R monoclonal antibody
    Target Antigen GM-Tg-g-MP1710-Ag SSTR4 VLP (virus-like particle)
    ORF Viral Vector pGMLP000761 Human SSTR4 Lentivirus plasmid
    ORF Viral Vector vGMLP000761 Human SSTR4 Lentivirus particle


    Target information

    Target ID GM-MP1710
    Target Name SSTR4
    Gene ID 6754, 20608, 702017, 25555, 101086552, 100049965
    Gene Symbol and Synonyms Smstr4,SS-4-R,SS4-R,SS4R,SST4,SSTR4
    Uniprot Accession P31391
    Uniprot Entry Name SSR4_HUMAN
    Protein Sub-location Transmembrane Protein
    Category Not Available
    Disease Not Available
    Gene Ensembl ENSG00000132671
    Target Classification GPCR

    Somatostatin acts at many sites to inhibit the release of many hormones and other secretory proteins.  The biologic effects of somatostatin are probably mediated by a family of G protein-coupled receptors that are expressed in a tissue-specific manner.  SSTR4 is a member of the superfamily of receptors having seven transmembrane segments and is expressed in highest levels in fetal and adult brain and lung. [provided by RefSeq, Jul 2008]



    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.