Human SSTR4/SS-4-R/SS4-R ORF/cDNA clone-Lentivirus plasmid (NM_001052)
Cat. No.: pGMLP000761
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days
Pre-made Human SSTR4/SS-4-R/SS4-R Lentiviral expression plasmid for SSTR4 lentivirus packaging, SSTR4 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.
Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.
Go to
SSTR4/SS-4-R products
collection>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product Description
Catalog ID | pGMLP000761 |
Gene Name | SSTR4 |
Accession Number | NM_001052 |
Gene ID | 6754 |
Species | Human |
Product Type | Lentivirus plasmid (overexpression) |
Insert Length | 1167 bp |
Gene Alias | SS-4-R,SS4-R,SS4R |
Fluorescent Reporter | ZsGreen |
Mammalian Cell Selection | Puromyocin |
Fusion Tag | 3xflag (C-Terminal) |
Promoter | CMV |
Resistance | Amplicin |
ORF Nucleotide Sequence | ATGAGCGCCCCCTCGACGCTGCCCCCCGGGGGCGAGGAAGGGCTGGGGACGGCCTGGCCCTCTGCAGCCAATGCCAGTAGCGCTCCGGCGGAGGCGGAGGAGGCGGTGGCGGGGCCCGGGGACGCGCGGGCGGCGGGCATGGTCGCTATCCAGTGCATCTACGCGCTGGTGTGCCTGGTGGGGCTGGTGGGCAACGCCCTGGTCATCTTCGTGATCCTTCGCTACGCCAAGATGAAGACGGCTACCAACATCTACCTGCTCAACCTGGCCGTAGCCGACGAGCTCTTCATGCTGAGCGTGCCCTTCGTGGCCTCGTCGGCCGCCCTGCGCCACTGGCCCTTCGGCTCCGTGCTGTGCCGCGCGGTGCTCAGCGTCGACGGCCTCAACATGTTCACCAGCGTCTTCTGTCTCACCGTGCTCAGCGTGGACCGCTACGTGGCCGTGGTGCACCCTCTGCGCGCGGCGACCTACCGGCGGCCCAGCGTGGCCAAGCTCATCAACCTGGGCGTGTGGCTGGCATCCCTGTTGGTCACTCTCCCCATCGCCATCTTCGCAGACACCAGACCGGCTCGCGGCGGCCAGGCCGTGGCCTGCAACCTGCAGTGGCCACACCCGGCCTGGTCGGCAGTCTTCGTGGTCTACACTTTCCTGCTGGGCTTCCTGCTGCCCGTGCTGGCCATTGGCCTGTGCTACCTGCTCATCGTGGGCAAGATGCGCGCCGTGGCCCTGCGCGCTGGCTGGCAGCAGCGCAGGCGCTCGGAGAAGAAAATCACCAGGCTGGTGCTGATGGTCGTGGTCGTCTTTGTGCTCTGCTGGATGCCTTTCTACGTGGTGCAGCTGCTGAACCTCTTCGTGACCAGCCTTGATGCCACCGTCAACCACGTGTCCCTTATCCTTAGCTATGCCAACAGCTGCGCCAACCCCATTCTCTATGGCTTCCTCTCCGACAACTTCCGCCGATTCTTCCAGCGGGTTCTCTGCCTGCGCTGCTGCCTCCTGGAAGGTGCTGGAGGTGCTGAGGAGGAGCCCCTGGACTACTATGCCACTGCTCTCAAGAGCAAAGGTGGGGCAGGGTGCATGTGCCCCCCACTCCCCTGCCAGCAGGAAGCCCTGCAACCAGAACCCGGCCGCAAGCGCATCCCCCTCACCAGGACCACCACCTTCTGA |
ORF Protein Sequence | MSAPSTLPPGGEEGLGTAWPSAANASSAPAEAEEAVAGPGDARAAGMVAIQCIYALVCLVGLVGNALVIFVILRYAKMKTATNIYLLNLAVADELFMLSVPFVASSAALRHWPFGSVLCRAVLSVDGLNMFTSVFCLTVLSVDRYVAVVHPLRAATYRRPSVAKLINLGVWLASLLVTLPIAIFADTRPARGGQAVACNLQWPHPAWSAVFVVYTFLLGFLLPVLAIGLCYLLIVGKMRAVALRAGWQQRRRSEKKITRLVLMVVVVFVLCWMPFYVVQLLNLFVTSLDATVNHVSLILSYANSCANPILYGFLSDNFRRFFQRVLCLRCCLLEGAGGAEEEPLDYYATALKSKGGAGCMCPPLPCQQEALQPEPGRKRIPLTRTTTF |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
Category | Cat No. | Products Name |
---|---|---|
Target Antibody | GM-Tg-g-MP1710-Ab | Anti-SSR4/ SSTR4/ SS-4-R monoclonal antibody |
Target Antigen | GM-Tg-g-MP1710-Ag | SSTR4 VLP (virus-like particle) |
ORF Viral Vector | pGMLP000761 | Human SSTR4 Lentivirus plasmid |
ORF Viral Vector | vGMLP000761 | Human SSTR4 Lentivirus particle |
Target information
Target ID | GM-MP1710 |
Target Name | SSTR4 |
Gene ID | 6754, 20608, 702017, 25555, 101086552, 100049965 |
Gene Symbol and Synonyms | Smstr4,SS-4-R,SS4-R,SS4R,SST4,SSTR4 |
Uniprot Accession | P31391 |
Uniprot Entry Name | SSR4_HUMAN |
Protein Sub-location | Transmembrane Protein |
Category | Not Available |
Disease | Not Available |
Gene Ensembl | ENSG00000132671 |
Target Classification | GPCR |
Somatostatin acts at many sites to inhibit the release of many hormones and other secretory proteins. The biologic effects of somatostatin are probably mediated by a family of G protein-coupled receptors that are expressed in a tissue-specific manner. SSTR4 is a member of the superfamily of receptors having seven transmembrane segments and is expressed in highest levels in fetal and adult brain and lung. [provided by RefSeq, Jul 2008]
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.