Human GNRH1/GNRH/ GRH ORF/cDNA clone-Lentivirus plasmid (NM_000825)

Pre-made Human GNRH1/GNRH/ GRH Lentiviral expression plasmid for GNRH1 lentivirus packaging, GNRH1 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.

Target products collectionGo to GNRH1/GNRH products collection >>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)



Product information

Catalog No. Product Name Plasmid Grade Plasmid quantity
pGMLP000781 Human GNRH1 Lentivirus plasmid Research Grade 10mg, 50mg, 100mg, 500mg, >1g
GMP-like Grade 10mg, 50mg, 100mg, 500mg, >1g
High Quality (HQ) Grade
Seed 5ug


Product Description

Catalog ID pGMLP000781
Gene Name GNRH1
Accession Number NM_000825
Gene ID 2796
Species Human
Product Type Lentivirus plasmid (overexpression)
Insert Length 291 bp
Gene Alias GNRH, GRH, LHRH, LNRH
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
Sequence ATGTGCCTTAGAATGAAGCCAATTCAAAAACTCCTAGCTGGCCTTATTCTACTGACTTGGTGCGTGGAAGGCTGCTCCAGCCAGCACTGGTCCTATGGACTGCGCCCTGGAGGAAAGAGAGATGCCGAAAATTTGATTGATTCTTTCCAAGAGATAGTCAAAGAGGTTGGTCAACTGGCAGAAACCCAACGCTTCGAATGCACCACGCACCAGCCACGTTCTCCCCTCCGAGACCTGAAAGGAGCTCTGGAAAGTCTGATTGAAGAGGAAACTGGGCAGAAGAAGATTTAA

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-T18950-Ab Anti-GON1/ GNRH1/ GNRH functional antibody
    Target Antigen GM-Tg-g-T18950-Ag GNRH1 protein
    ORF Viral Vector pGMLP000781 Human GNRH1 Lentivirus plasmid
    ORF Viral Vector vGMLP000781 Human GNRH1 Lentivirus particle


    Target information

    Target ID GM-T18950
    Target Name GNRH1
    Gene ID 2796, 14714, 613033, 25194, 101080783, 608671, 768325, 100630270
    Gene Symbol and Synonyms GNRH,GNRH1,Gnrh2,Gnrha,GRH,hpg,LHRH,Lhrh1,LNRH,Rgnrhg1,SH-4
    Uniprot Accession P01148
    Uniprot Entry Name GON1_HUMAN
    Protein Sub-location Secreted Protein/Potential Cytokines
    Category Therapeutics Target
    Disease Not Available
    Gene Ensembl ENSG00000147437
    Target Classification Not Available

    This gene encodes a preproprotein that is proteolytically processed to generate a peptide that is a member of the gonadotropin-releasing hormone (GnRH) family of peptides. Alternative splicing results in multiple transcript variants, at least one of which is secreted and then cleaved to generate gonadoliberin-1 and GnRH-associated peptide 1. Gonadoliberin-1 stimulates the release of luteinizing and follicle stimulating hormones, which are important for reproduction. Mutations in this gene are associated with hypogonadotropic hypogonadism. [provided by RefSeq, Nov 2015]



    About GMVC

    GDU



    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.