Human IGFBP6/IBP6 ORF/cDNA clone-Lentivirus plasmid (NM_002178)

Pre-made Human IGFBP6/IBP6 Lentiviral expression plasmid for IGFBP6 lentivirus packaging, IGFBP6 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.

Target products collectionGo to IGFBP6/IBP6 products collection >>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)



Product information

Catalog No. Product Name Plasmid Grade Plasmid quantity
pGMLP000789 Human IGFBP6 Lentivirus plasmid Research Grade 10mg, 50mg, 100mg, 500mg, >1g
GMP-like Grade 10mg, 50mg, 100mg, 500mg, >1g
High Quality (HQ) Grade
Seed 5ug


Product Description

Catalog ID pGMLP000789
Gene Name IGFBP6
Accession Number NM_002178
Gene ID 3489
Species Human
Product Type Lentivirus plasmid (overexpression)
Insert Length 723 bp
Gene Alias IBP6
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
Sequence ATGACCCCCCACAGGCTGCTGCCACCGCTGCTGCTGCTGCTAGCTCTGCTGCTCGCTGCCAGCCCAGGAGGCGCCTTGGCGCGGTGCCCAGGCTGCGGGCAAGGGGTGCAGGCGGGTTGTCCAGGGGGCTGCGTGGAGGAGGAGGATGGGGGGTCGCCAGCCGAGGGCTGCGCGGAAGCTGAGGGCTGTCTCAGGAGGGAGGGGCAGGAGTGCGGGGTCTACACCCCTAACTGCGCCCCAGGACTGCAGTGCCATCCGCCCAAGGACGACGAGGCGCCTTTGCGGGCGCTGCTGCTCGGCCGAGGCCGCTGCCTTCCGGCCCGCGCGCCTGCTGTTGCAGAGGAGAATCCTAAGGAGAGTAAACCCCAAGCAGGCACTGCCCGCCCACAGGATGTGAACCGCAGAGACCAACAGAGGAATCCAGGCACCTCTACCACGCCCTCCCAGCCCAATTCTGCGGGTGTCCAAGACACTGAGATGGGCCCATGCCGTAGACATCTGGACTCAGTGCTGCAGCAACTCCAGACTGAGGTCTACCGAGGGGCTCAAACACTCTACGTGCCCAATTGTGACCATCGAGGCTTCTACCGGAAGCGGCAGTGCCGCTCCTCCCAGGGGCAGCGCCGAGGTCCCTGCTGGTGTGTGGATCGGATGGGCAAGTCCCTGCCAGGGTCTCCAGATGGCAATGGAAGCTCCTCCTGCCCCACTGGGAGTAGCGGCTAA

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-T61800-Ab Anti-IBP6/ IGFBP6 functional antibody
    Target Antigen GM-Tg-g-T61800-Ag IGFBP6 protein
    Cytokine cks-Tg-g-GM-T61800 insulin-like growth factor binding protein 6 (IGFBP6) protein & antibody
    ORF Viral Vector pGMLP000789 Human IGFBP6 Lentivirus plasmid
    ORF Viral Vector vGMLP000789 Human IGFBP6 Lentivirus particle


    Target information

    Target ID GM-T61800
    Target Name IGFBP6
    Gene ID 3489, 16012, 699022, 25641, 101082759, 607374, 404186, 100034156
    Gene Symbol and Synonyms IBP6,IGF-BP6,IGFBP-6,IGFBP6,RBP6A,RBP6G
    Uniprot Accession P24592
    Uniprot Entry Name IBP6_HUMAN
    Protein Sub-location Secreted Protein/Potential Cytokines
    Category Therapeutics Target, Cytokine Target
    Disease Prostate Cancer, Dent disease
    Gene Ensembl ENSG00000167779
    Target Classification Not Available

    Enables identical protein binding activity and insulin-like growth factor II binding activity. Involved in cell migration and positive regulation of stress-activated MAPK cascade. Part of insulin-like growth factor binary complex. Implicated in obesity. Biomarker of breast cancer; in situ carcinoma; leiomyoma; and neovascular inflammatory vitreoretinopathy. [provided by Alliance of Genome Resources, Apr 2022]



    About GMVC

    GDU



    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.