Human IGFBP6/IBP6 ORF/cDNA clone-Lentivirus particle (NM_002178)
Pre-made Human IGFBP6/IBP6 Lentiviral expression plasmid for IGFBP6 lentivirus packaging, IGFBP6 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.
The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.
Go
to IGFBP6/IBP6 products collection
>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product information
Catalog No. | Product Name | lentivirus Grade | lentivirus quantity |
---|---|---|---|
vGMLP000789 | Human IGFBP6 Lentivirus particle | Pilot Grade | 1.0E+8TU |
5.0E+8TU | |||
1.0E+9TU | |||
Research Grade | 1.0E+8TU | ||
5.0E+8TU | |||
1.0E+9TU | |||
GMP-like Grade | inquiry | ||
GMP Grade | inquiry |
Product Description
Catalog ID | vGMLP000789 |
Gene Name | IGFBP6 |
Accession Number | NM_002178 |
Gene ID | 3489 |
Species | Human |
Product Type | Lentivirus particle (overexpression) |
Insert Length | 723 bp |
Gene Alias | IBP6 |
Fluorescent Reporter | ZsGreen |
Mammalian Cell Selection | Puromyocin |
Fusion Tag | 3xflag (C-Terminal) |
Promoter | CMV |
Resistance | Amplicin |
Sequence | ATGACCCCCCACAGGCTGCTGCCACCGCTGCTGCTGCTGCTAGCTCTGCTGCTCGCTGCCAGCCCAGGAGGCGCCTTGGCGCGGTGCCCAGGCTGCGGGCAAGGGGTGCAGGCGGGTTGTCCAGGGGGCTGCGTGGAGGAGGAGGATGGGGGGTCGCCAGCCGAGGGCTGCGCGGAAGCTGAGGGCTGTCTCAGGAGGGAGGGGCAGGAGTGCGGGGTCTACACCCCTAACTGCGCCCCAGGACTGCAGTGCCATCCGCCCAAGGACGACGAGGCGCCTTTGCGGGCGCTGCTGCTCGGCCGAGGCCGCTGCCTTCCGGCCCGCGCGCCTGCTGTTGCAGAGGAGAATCCTAAGGAGAGTAAACCCCAAGCAGGCACTGCCCGCCCACAGGATGTGAACCGCAGAGACCAACAGAGGAATCCAGGCACCTCTACCACGCCCTCCCAGCCCAATTCTGCGGGTGTCCAAGACACTGAGATGGGCCCATGCCGTAGACATCTGGACTCAGTGCTGCAGCAACTCCAGACTGAGGTCTACCGAGGGGCTCAAACACTCTACGTGCCCAATTGTGACCATCGAGGCTTCTACCGGAAGCGGCAGTGCCGCTCCTCCCAGGGGCAGCGCCGAGGTCCCTGCTGGTGTGTGGATCGGATGGGCAAGTCCCTGCCAGGGTCTCCAGATGGCAATGGAAGCTCCTCCTGCCCCACTGGGAGTAGCGGCTAA |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
Category | Cat No. | Products Name |
---|---|---|
Target Antibody | GM-Tg-g-T61800-Ab | Anti-IBP6/ IGFBP6 functional antibody |
Target Antigen | GM-Tg-g-T61800-Ag | IGFBP6 protein |
Cytokine | cks-Tg-g-GM-T61800 | insulin-like growth factor binding protein 6 (IGFBP6) protein & antibody |
ORF Viral Vector | pGMLP000789 | Human IGFBP6 Lentivirus plasmid |
ORF Viral Vector | vGMLP000789 | Human IGFBP6 Lentivirus particle |
Target information
Target ID | GM-T61800 |
Target Name | IGFBP6 |
Gene ID | 3489, 16012, 699022, 25641, 101082759, 607374, 404186, 100034156 |
Gene Symbol and Synonyms | IBP6,IGF-BP6,IGFBP-6,IGFBP6,RBP6A,RBP6G |
Uniprot Accession | P24592 |
Uniprot Entry Name | IBP6_HUMAN |
Protein Sub-location | Secreted Protein/Potential Cytokines |
Category | Therapeutics Target, Cytokine Target |
Disease | Prostate Cancer, Dent disease |
Gene Ensembl | ENSG00000167779 |
Target Classification | Not Available |
Enables identical protein binding activity and insulin-like growth factor II binding activity. Involved in cell migration and positive regulation of stress-activated MAPK cascade. Part of insulin-like growth factor binary complex. Implicated in obesity. Biomarker of breast cancer; in situ carcinoma; leiomyoma; and neovascular inflammatory vitreoretinopathy. [provided by Alliance of Genome Resources, Apr 2022]
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.