Human PRSS1/TRP1/ TRY4 ORF/cDNA clone-Lentivirus plasmid (BC128226)
Pre-made Human PRSS1/TRP1/ TRY4 Lentiviral expression plasmid for PRSS1 lentivirus packaging, PRSS1 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.
Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.
Go
to PRSS1/TRP1 products collection
>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product information
Catalog No. | Product Name | Plasmid Grade | Plasmid quantity |
---|---|---|---|
pGMLP000797 | Human PRSS1 Lentivirus plasmid | Research Grade | 10mg, 50mg, 100mg, 500mg, >1g |
GMP-like Grade | 10mg, 50mg, 100mg, 500mg, >1g | ||
High Quality (HQ) Grade | |||
Seed | 5ug |
Product Description
Catalog ID | pGMLP000797 |
Gene Name | PRSS1 |
Accession Number | BC128226 |
Gene ID | 5644 |
Species | Human |
Product Type | Lentivirus plasmid (overexpression) |
Insert Length | 744 bp |
Gene Alias | TRP1, TRY4, TRYP1 |
Fluorescent Reporter | ZsGreen |
Mammalian Cell Selection | Puromyocin |
Fusion Tag | 3xflag (C-Terminal) |
Promoter | CMV |
Resistance | Amplicin |
Sequence | ATGAATCCATTCCTGATCCTTACCTTTGTGGCAGCTGCTCTTGCTGCCCCCTTTGATGATGATGACAAGATCGTTGGGGGCTACAACTGTGAGGAGAATTCTGTCCCCTACCAGGTGTCCCTGAATTCTGGCTACCACTTCTGTGGTGGCTCCCTCATCAACGAACAGTGGGTGGTATCAGCAGGCCACTGCTACAAGTCCCGCATCCAGGTGAGACTGGGAGAGCACAACATCGAAGTCCTGGAGGGGAATGAGCAGTTCATCAATGCAGCCAAGATCATCCGCCACCCCCAATACGACAGGAAGACTCTGAACAATGACATCATGTTAATCAAGCTCTCCTCACGTGCAGTAATCAACGCCCGCGTGTCCACCATCTCTCTGCCCACCGCCCCTCCAGCCACTGGCACGAAGTGCCTCATCTCTGGCTGGGGCAACACTGCGAGCTCTGGCGCCGACTACCCAGACGAGCTGCAGTGCCTGGATGCTCCTGTGCTGAGCCAGGCTAAGTGTGAAGCCTCCTACCCTGGAAAGATTACCAGCAACATGTTCTGTGTGGGCTTCCTTGAGGGAGGCAAGGATTCATGTCAGGGTGATTCTGGTGGCCCTGTGGTCTGCAATGGACAGCTCCAAGGAGTTGTCTCCTGGGGTGATGGCTGTGCCCAGAAGAACAAGCCTGGAGTCTACACCAAGGTCTACAACTATGTGAAATGGATTAAGAACACCATAGCTGCCAATAGCTAA |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
Category | Cat No. | Products Name |
---|---|---|
Target Antibody | GM-Tg-g-T27602-Ab | Anti-TRY1/ PRSS1/ TRP1 functional antibody |
Target Antigen | GM-Tg-g-T27602-Ag | PRSS1 protein |
ORF Viral Vector | pGMLP000797 | Human PRSS1 Lentivirus plasmid |
ORF Viral Vector | vGMLP000797 | Human PRSS1 Lentivirus particle |
Target information
Target ID | GM-T27602 |
Target Name | PRSS1 |
Gene ID | 5644 |
Gene Symbol and Synonyms | PRSS1,TRP1,TRY1,TRY4,TRYP1 |
Uniprot Accession | P07477 |
Uniprot Entry Name | TRY1_HUMAN |
Protein Sub-location | Secreted Protein/Potential Cytokines |
Category | Therapeutics Target |
Disease | Cancer |
Gene Ensembl | ENSG00000204983 |
Target Classification | Tumor-associated antigen (TAA) |
This gene encodes a trypsinogen, which is a member of the trypsin family of serine proteases. This enzyme is secreted by the pancreas and cleaved to its active form in the small intestine. It is active on peptide linkages involving the carboxyl group of lysine or arginine. Mutations in this gene are associated with hereditary pancreatitis. This gene and several other trypsinogen genes are localized to the T cell receptor beta locus on chromosome 7. [provided by RefSeq, Jul 2008]
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.