Human PRSS1/TRP1/ TRY4 ORF/cDNA clone-Lentivirus plasmid (BC128226)

Pre-made Human PRSS1/TRP1/ TRY4 Lentiviral expression plasmid for PRSS1 lentivirus packaging, PRSS1 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.

Target products collectionGo to PRSS1/TRP1 products collection >>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)



Product information

Catalog No. Product Name Plasmid Grade Plasmid quantity
pGMLP000797 Human PRSS1 Lentivirus plasmid Research Grade 10mg, 50mg, 100mg, 500mg, >1g
GMP-like Grade 10mg, 50mg, 100mg, 500mg, >1g
High Quality (HQ) Grade
Seed 5ug


Product Description

Catalog ID pGMLP000797
Gene Name PRSS1
Accession Number BC128226
Gene ID 5644
Species Human
Product Type Lentivirus plasmid (overexpression)
Insert Length 744 bp
Gene Alias TRP1, TRY4, TRYP1
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
Sequence ATGAATCCATTCCTGATCCTTACCTTTGTGGCAGCTGCTCTTGCTGCCCCCTTTGATGATGATGACAAGATCGTTGGGGGCTACAACTGTGAGGAGAATTCTGTCCCCTACCAGGTGTCCCTGAATTCTGGCTACCACTTCTGTGGTGGCTCCCTCATCAACGAACAGTGGGTGGTATCAGCAGGCCACTGCTACAAGTCCCGCATCCAGGTGAGACTGGGAGAGCACAACATCGAAGTCCTGGAGGGGAATGAGCAGTTCATCAATGCAGCCAAGATCATCCGCCACCCCCAATACGACAGGAAGACTCTGAACAATGACATCATGTTAATCAAGCTCTCCTCACGTGCAGTAATCAACGCCCGCGTGTCCACCATCTCTCTGCCCACCGCCCCTCCAGCCACTGGCACGAAGTGCCTCATCTCTGGCTGGGGCAACACTGCGAGCTCTGGCGCCGACTACCCAGACGAGCTGCAGTGCCTGGATGCTCCTGTGCTGAGCCAGGCTAAGTGTGAAGCCTCCTACCCTGGAAAGATTACCAGCAACATGTTCTGTGTGGGCTTCCTTGAGGGAGGCAAGGATTCATGTCAGGGTGATTCTGGTGGCCCTGTGGTCTGCAATGGACAGCTCCAAGGAGTTGTCTCCTGGGGTGATGGCTGTGCCCAGAAGAACAAGCCTGGAGTCTACACCAAGGTCTACAACTATGTGAAATGGATTAAGAACACCATAGCTGCCAATAGCTAA

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-T27602-Ab Anti-TRY1/ PRSS1/ TRP1 functional antibody
    Target Antigen GM-Tg-g-T27602-Ag PRSS1 protein
    ORF Viral Vector pGMLP000797 Human PRSS1 Lentivirus plasmid
    ORF Viral Vector vGMLP000797 Human PRSS1 Lentivirus particle


    Target information

    Target ID GM-T27602
    Target Name PRSS1
    Gene ID 5644
    Gene Symbol and Synonyms PRSS1,TRP1,TRY1,TRY4,TRYP1
    Uniprot Accession P07477
    Uniprot Entry Name TRY1_HUMAN
    Protein Sub-location Secreted Protein/Potential Cytokines
    Category Therapeutics Target
    Disease Cancer
    Gene Ensembl ENSG00000204983
    Target Classification Tumor-associated antigen (TAA)

    This gene encodes a trypsinogen, which is a member of the trypsin family of serine proteases. This enzyme is secreted by the pancreas and cleaved to its active form in the small intestine. It is active on peptide linkages involving the carboxyl group of lysine or arginine. Mutations in this gene are associated with hereditary pancreatitis. This gene and several other trypsinogen genes are localized to the T cell receptor beta locus on chromosome 7. [provided by RefSeq, Jul 2008]



    About GMVC

    GDU



    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.