Human CCL25/Ckb15/ TECK ORF/cDNA clone-Lentivirus plasmid (BC130561)
Pre-made Human CCL25/Ckb15/ TECK Lentiviral expression plasmid for CCL25 lentivirus packaging, CCL25 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.
Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.
Go
to CCL25/Ckb15 products collection
>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product information
Catalog No. | Product Name | Plasmid Grade | Plasmid quantity |
---|---|---|---|
pGMLP000799 | Human CCL25 Lentivirus plasmid | Research Grade | 10mg, 50mg, 100mg, 500mg, >1g |
GMP-like Grade | 10mg, 50mg, 100mg, 500mg, >1g | ||
High Quality (HQ) Grade | |||
Seed | 5ug |
Product Description
Catalog ID | pGMLP000799 |
Gene Name | CCL25 |
Accession Number | BC130561 |
Gene ID | 6370 |
Species | Human |
Product Type | Lentivirus plasmid (overexpression) |
Insert Length | 453 bp |
Gene Alias | Ckb15, TECK |
Fluorescent Reporter | ZsGreen |
Mammalian Cell Selection | Puromyocin |
Fusion Tag | 3xflag (C-Terminal) |
Promoter | CMV |
Resistance | Amplicin |
Sequence | ATGAACCTGTGGCTCCTGGCCTGCCTGGTGGCCGGCTTCCTGGGAGCCTGGGCCCCCGCTGTCCACACCCAAGGTGTCTTTGAGGACTGCTGCCTGGCCTACCACTACCCCATTGGGTGGGCTGTGCTCCGGCGCGCCTGGACTTACCGGATCCAGGAGGTGAGCGGGAGCTGCAATCTGCCTGCTGCGATATTCTACCTCCCCAAGAGACACAGGAAGGTGTGTGGGAACCCCAAAAGCAGGGAGGTGCAGAGAGCCATGAAGCTCCTGGATGCTCGAAATAAGGTTTTTGCAAAGCTCCACCACAACACGCAGACCTTCCAAGCAGGCCCTCATGCTGTAAAGAAGTTGAGTTCTGGAAACTCCAAGTTATCATCATCCAAGTTTAGCAATCCCATCAGCAGCAGCAAGAGGAATGTCTCCCTCCTGATATCAGCTAATTCAGGACTGTGA |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
Category | Cat No. | Products Name |
---|---|---|
Target Antibody | GM-Tg-g-SE0745-Ab | Anti-CCL25/ Ckb15/ SCYA25 functional antibody |
Target Antigen | GM-Tg-g-SE0745-Ag | CCL25 protein |
Cytokine | cks-Tg-g-GM-SE0745 | chemokine (C-C motif) ligand 25 (CCL25) protein & antibody |
ORF Viral Vector | pGMLP000799 | Human CCL25 Lentivirus plasmid |
ORF Viral Vector | vGMLP000799 | Human CCL25 Lentivirus particle |
Target information
Target ID | GM-SE0745 |
Target Name | CCL25 |
Gene ID | 6370, 20300, 574219, 360750, 102899861, 448798, 615986, 100066885 |
Gene Symbol and Synonyms | A130072A22Rik,CCL25,Ck beta-15,Ckb15,SCYA25,TECK,TECKvar |
Uniprot Accession | O15444 |
Uniprot Entry Name | CCL25_HUMAN |
Protein Sub-location | Secreted Protein/Potential Cytokines |
Category | Cytokine Target |
Disease | Not Available |
Gene Ensembl | ENSG00000131142 |
Target Classification | Not Available |
This antimicrobial gene belongs to the subfamily of small cytokine CC genes. Cytokines are a family of secreted proteins involved in immunoregulatory and inflammatory processes. The CC cytokines are proteins characterized by two adjacent cysteines. The cytokine encoded by this gene displays chemotactic activity for dendritic cells, thymocytes, and activated macrophages but is inactive on peripheral blood lymphocytes and neutrophils. The product of this gene binds to chemokine receptor CCR9. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2014]
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.