Human CCL25/Ckb15/ TECK ORF/cDNA clone-Lentivirus particle (BC130561)

Pre-made Human CCL25/Ckb15/ TECK Lentiviral expression plasmid for CCL25 lentivirus packaging, CCL25 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.

Target products collectionGo to CCL25/Ckb15 products collection >>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)



Product information

Catalog No. Product Name lentivirus Grade lentivirus quantity
vGMLP000799 Human CCL25 Lentivirus particle Pilot Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
Research Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
GMP-like Grade inquiry
GMP Grade inquiry


Product Description

Catalog ID vGMLP000799
Gene Name CCL25
Accession Number BC130561
Gene ID 6370
Species Human
Product Type Lentivirus particle (overexpression)
Insert Length 453 bp
Gene Alias Ckb15, TECK
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
Sequence ATGAACCTGTGGCTCCTGGCCTGCCTGGTGGCCGGCTTCCTGGGAGCCTGGGCCCCCGCTGTCCACACCCAAGGTGTCTTTGAGGACTGCTGCCTGGCCTACCACTACCCCATTGGGTGGGCTGTGCTCCGGCGCGCCTGGACTTACCGGATCCAGGAGGTGAGCGGGAGCTGCAATCTGCCTGCTGCGATATTCTACCTCCCCAAGAGACACAGGAAGGTGTGTGGGAACCCCAAAAGCAGGGAGGTGCAGAGAGCCATGAAGCTCCTGGATGCTCGAAATAAGGTTTTTGCAAAGCTCCACCACAACACGCAGACCTTCCAAGCAGGCCCTCATGCTGTAAAGAAGTTGAGTTCTGGAAACTCCAAGTTATCATCATCCAAGTTTAGCAATCCCATCAGCAGCAGCAAGAGGAATGTCTCCCTCCTGATATCAGCTAATTCAGGACTGTGA

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-SE0745-Ab Anti-CCL25/ Ckb15/ SCYA25 functional antibody
    Target Antigen GM-Tg-g-SE0745-Ag CCL25 protein
    Cytokine cks-Tg-g-GM-SE0745 chemokine (C-C motif) ligand 25 (CCL25) protein & antibody
    ORF Viral Vector pGMLP000799 Human CCL25 Lentivirus plasmid
    ORF Viral Vector vGMLP000799 Human CCL25 Lentivirus particle


    Target information

    Target ID GM-SE0745
    Target Name CCL25
    Gene ID 6370, 20300, 574219, 360750, 102899861, 448798, 615986, 100066885
    Gene Symbol and Synonyms A130072A22Rik,CCL25,Ck beta-15,Ckb15,SCYA25,TECK,TECKvar
    Uniprot Accession O15444
    Uniprot Entry Name CCL25_HUMAN
    Protein Sub-location Secreted Protein/Potential Cytokines
    Category Cytokine Target
    Disease Not Available
    Gene Ensembl ENSG00000131142
    Target Classification Not Available

    This antimicrobial gene belongs to the subfamily of small cytokine CC genes. Cytokines are a family of secreted proteins involved in immunoregulatory and inflammatory processes. The CC cytokines are proteins characterized by two adjacent cysteines. The cytokine encoded by this gene displays chemotactic activity for dendritic cells, thymocytes, and activated macrophages but is inactive on peripheral blood lymphocytes and neutrophils. The product of this gene binds to chemokine receptor CCR9. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2014]



    About GMVC

    GDU



    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.