Human CCL8/HC14/ MCP-2 ORF/cDNA clone-Lentivirus plasmid (BC126242)
Pre-made Human CCL8/HC14/ MCP-2 Lentiviral expression plasmid for CCL8 lentivirus packaging, CCL8 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.
Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.
Go
to CCL8/HC14 products collection
>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product information
Catalog No. | Product Name | Plasmid Grade | Plasmid quantity |
---|---|---|---|
pGMLP000800 | Human CCL8 Lentivirus plasmid | Research Grade | 10mg, 50mg, 100mg, 500mg, >1g |
GMP-like Grade | 10mg, 50mg, 100mg, 500mg, >1g | ||
High Quality (HQ) Grade | |||
Seed | 5ug |
Product Description
Catalog ID | pGMLP000800 |
Gene Name | CCL8 |
Accession Number | BC126242 |
Gene ID | 6355 |
Species | Human |
Product Type | Lentivirus plasmid (overexpression) |
Insert Length | 300 bp |
Gene Alias | HC14, MCP-2, MCP2, SCYA10 |
Fluorescent Reporter | ZsGreen |
Mammalian Cell Selection | Puromyocin |
Fusion Tag | 3xflag (C-Terminal) |
Promoter | CMV |
Resistance | Amplicin |
Sequence | ATGAAGGTTTCTGCAGCGCTTCTGTGCCTGCTGCTCATGGCAGCCACTTTCAGCCCTCAGGGACTTGCTCAGCCAGATTCAGTTTCCATTCCAATCACCTGCTGCTTTAACGTGATCAATAGGAAAATTCCTATCCAGAGGCTGGAGAGCTACACAAGAATCACCAACATCCAATGTCCCAAGGAAGCTGTGATCTTCAAGACCCAACGGGGCAAGGAGGTCTGTGCTGACCCCAAGGAGAGATGGGTCAGGGATTCCATGAAGCATCTGGACCAAATATTTCAAAATCTGAAGCCATGA |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
Category | Cat No. | Products Name |
---|---|---|
Target Antibody | GM-Tg-g-SE0751-Ab | Anti-CCL8/ HC14/ MCP-2 functional antibody |
Target Antigen | GM-Tg-g-SE0751-Ag | CCL8 protein |
Cytokine | cks-Tg-g-GM-SE0751 | chemokine (C-C motif) ligand 8 (CCL8) protein & antibody |
ORF Viral Vector | pGMPC000252 | Human CCL8 Mammalian (Non-Viral Vector) plasmid |
ORF Viral Vector | pGMLP000800 | Human CCL8 Lentivirus plasmid |
ORF Viral Vector | vGMLP000800 | Human CCL8 Lentivirus particle |
Target information
Target ID | GM-SE0751 |
Target Name | CCL8 |
Gene ID | 6355, 574179, 101097189 |
Gene Symbol and Synonyms | CCL8,HC14,MCP-2,MCP2,SCYA10,SCYA8 |
Uniprot Accession | P80075 |
Uniprot Entry Name | CCL8_HUMAN |
Protein Sub-location | Secreted Protein/Potential Cytokines |
Category | Cytokine Target |
Disease | Not Available |
Gene Ensembl | ENSG00000108700 |
Target Classification | Not Available |
This antimicrobial gene is one of several chemokine genes clustered on the q-arm of chromosome 17. Chemokines form a superfamily of secreted proteins involved in immunoregulatory and inflammatory processes. The superfamily is divided into four subfamilies based on the arrangement of N-terminal cysteine residues of the mature peptide. This chemokine is a member of the CC subfamily which is characterized by two adjacent cysteine residues. This cytokine displays chemotactic activity for monocytes, lymphocytes, basophils and eosinophils. By recruiting leukocytes to sites of inflammation this cytokine may contribute to tumor-associated leukocyte infiltration and to the antiviral state against HIV infection. [provided by RefSeq, Sep 2014]
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.