Human SMN1/BCD541/ GEMIN1 ORF/cDNA clone-Lentivirus plasmid (NM_022874)

Product information

Catalog No.	Product Name	Plasmid Grade	Plasmid quantity
pGMLP000812	Human SMN1 Lentivirus plasmid	Research Grade	10mg, 50mg, 100mg, 500mg, >1g
		GMP-like Grade	10mg, 50mg, 100mg, 500mg, >1g
		High Quality (HQ) Grade
		Seed	5ug

Product Description

Catalog ID	pGMLP000812
Gene Name	SMN1
Accession Number	NM_022874
Gene ID	6606
Species	Human
Product Type	Lentivirus plasmid (overexpression)
Insert Length	789 bp
Gene Alias	BCD541, GEMIN1, SMA, SMA1, SMA2, SMA3, SMA4, SMA@, SMN, SMNT, T-BCD541, TDRD16A
Fluorescent Reporter	ZsGreen
Mammalian Cell Selection	Puromyocin
Fusion Tag	3xflag (C-Terminal)
Promoter	CMV
Resistance	Amplicin
Sequence	ATGGCGATGAGCAGCGGCGGCAGTGGTGGCGGCGTCCCGGAGCAGGAGGATTCCGTGCTGTTCCGGCGCGGCACAGGCCAGAGCGATGATTCTGACATTTGGGATGATACAGCACTGATAAAAGCATATGATAAAGCTGTGGCTTCATTTAAGCATGCTCTAAAGAATGGTGACATTTGTGAAACTTCGGGTAAACCAAAAACCACACCTAAAAGAAAACCTGCTAAGAAGAATAAAAGCCAAAAGAAGAATACTGCAGCTTCCTTACAACAGTGGAAAGTTGGGGACAAATGTTCTGCCATTTGGTCAGAAGACGGTTGCATTTACCCAGCTACCATTGCTTCAATTGATTTTAAGAGAGAAACCTGTGTTGTGGTTTACACTGGATATGGAAATAGAGAGGAGCAAAATCTGTCCGATCTACTTTCCCCAATCTGTGAAGTAGCTAATAATATAGAACAAAATGCTCAAGAGAATGAAAATGAAAGCCAAGTTTCAACAGATGAAAGTGAGAACTCCAGGTCTCCTGGAAATAAATCAGATAACATCAAGCCCAAATCTGCTCCATGGAACTCTTTTCTCCCTCCACCACCCCCCATGCCAGGGCCAAGACTGGGACCAGGAAAGATAATTCCCCCACCACCTCCCATATGTCCAGATTCTCTTGATGATGCTGATGCTTTGGGAAGTATGTTAATTTCATGGTACATGAGTGGCTATCATACTGGCTATTATATGGGTTTCAGACAAAATCAAAAAGAAGGAAGGTGCTCACATTCCTTAAATTAA

Reference

Data / case study

Click to get more Data / Case study about the product.

Associated products

Category	Cat No.	Products Name
Target Antibody	GM-Tg-g-T71907-Ab	Anti-SMN1 monoclonal antibody
Target Antigen	GM-Tg-g-T71907-Ag	SMN1 protein
ORF Viral Vector	pGMLV001700	Human SMN1 Lentivirus plasmid
ORF Viral Vector	pGMLP000812	Human SMN1 Lentivirus plasmid
ORF Viral Vector	pGMLP000891	Human SMN2 Lentivirus plasmid
ORF Viral Vector	vGMLV001700	Human SMN1 Lentivirus particle
ORF Viral Vector	vGMLP000812	Human SMN1 Lentivirus particle
ORF Viral Vector	vGMLP000891	Human SMN2 Lentivirus particle

Target information

Target ID	GM-T71907
Target Name	SMN1
Gene ID	6606, 677703
Gene Symbol and Synonyms	BCD541,GEMIN1,SMA,SMA1,SMA2,SMA3,SMA4,SMA@,SMN,SMN1,SMNT,T-BCD541,TDRD16A
Uniprot Accession	Q16637
Uniprot Entry Name	SMN_HUMAN
Protein Sub-location	Introcelluar Protein
Category	Therapeutics Target
Disease	Not Available
Gene Ensembl	ENSG00000172062
Target Classification	Not Available

This gene is part of a 500 kb inverted duplication on chromosome 5q13. This duplicated region contains at least four genes and repetitive elements which make it prone to rearrangements and deletions. The repetitiveness and complexity of the sequence have also caused difficulty in determining the organization of this genomic region. The telomeric and centromeric copies of this gene are nearly identical and encode the same protein. However, mutations in this gene, the telomeric copy, are associated with spinal muscular atrophy; mutations in the centromeric copy do not lead to disease. The centromeric copy may be a modifier of disease caused by mutation in the telomeric copy. The critical sequence difference between the two genes is a single nucleotide in exon 7, which is thought to be an exon splice enhancer. Note that the nine exons of both the telomeric and centromeric copies are designated historically as exon 1, 2a, 2b, and 3-8. It is thought that gene conversion events may involve the two genes, leading to varying copy numbers of each gene. The protein encoded by this gene localizes to both the cytoplasm and the nucleus. Within the nucleus, the protein localizes to subnuclear bodies called gems which are found near coiled bodies containing high concentrations of small ribonucleoproteins (snRNPs). This protein forms heteromeric complexes with proteins such as SIP1 and GEMIN4, and also interacts with several proteins known to be involved in the biogenesis of snRNPs, such as hnRNP U protein and the small nucleolar RNA binding protein. Multiple transcript variants encoding distinct isoforms have been described. [provided by RefSeq, Jul 2014]

About GMVC