Human SMN1/BCD541/ GEMIN1 ORF/cDNA clone-Lentivirus plasmid (NM_022874)
Pre-made Human SMN1/BCD541/ GEMIN1 Lentiviral expression plasmid for SMN1 lentivirus packaging, SMN1 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.
Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.
Go
to SMN1/BCD541 products collection
>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product information
Catalog No. | Product Name | Plasmid Grade | Plasmid quantity |
---|---|---|---|
pGMLP000812 | Human SMN1 Lentivirus plasmid | Research Grade | 10mg, 50mg, 100mg, 500mg, >1g |
GMP-like Grade | 10mg, 50mg, 100mg, 500mg, >1g | ||
High Quality (HQ) Grade | |||
Seed | 5ug |
Product Description
Catalog ID | pGMLP000812 |
Gene Name | SMN1 |
Accession Number | NM_022874 |
Gene ID | 6606 |
Species | Human |
Product Type | Lentivirus plasmid (overexpression) |
Insert Length | 789 bp |
Gene Alias | BCD541, GEMIN1, SMA, SMA1, SMA2, SMA3, SMA4, SMA@, SMN, SMNT, T-BCD541, TDRD16A |
Fluorescent Reporter | ZsGreen |
Mammalian Cell Selection | Puromyocin |
Fusion Tag | 3xflag (C-Terminal) |
Promoter | CMV |
Resistance | Amplicin |
Sequence | ATGGCGATGAGCAGCGGCGGCAGTGGTGGCGGCGTCCCGGAGCAGGAGGATTCCGTGCTGTTCCGGCGCGGCACAGGCCAGAGCGATGATTCTGACATTTGGGATGATACAGCACTGATAAAAGCATATGATAAAGCTGTGGCTTCATTTAAGCATGCTCTAAAGAATGGTGACATTTGTGAAACTTCGGGTAAACCAAAAACCACACCTAAAAGAAAACCTGCTAAGAAGAATAAAAGCCAAAAGAAGAATACTGCAGCTTCCTTACAACAGTGGAAAGTTGGGGACAAATGTTCTGCCATTTGGTCAGAAGACGGTTGCATTTACCCAGCTACCATTGCTTCAATTGATTTTAAGAGAGAAACCTGTGTTGTGGTTTACACTGGATATGGAAATAGAGAGGAGCAAAATCTGTCCGATCTACTTTCCCCAATCTGTGAAGTAGCTAATAATATAGAACAAAATGCTCAAGAGAATGAAAATGAAAGCCAAGTTTCAACAGATGAAAGTGAGAACTCCAGGTCTCCTGGAAATAAATCAGATAACATCAAGCCCAAATCTGCTCCATGGAACTCTTTTCTCCCTCCACCACCCCCCATGCCAGGGCCAAGACTGGGACCAGGAAAGATAATTCCCCCACCACCTCCCATATGTCCAGATTCTCTTGATGATGCTGATGCTTTGGGAAGTATGTTAATTTCATGGTACATGAGTGGCTATCATACTGGCTATTATATGGGTTTCAGACAAAATCAAAAAGAAGGAAGGTGCTCACATTCCTTAAATTAA |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
Category | Cat No. | Products Name |
---|---|---|
Target Antibody | GM-Tg-g-T71907-Ab | Anti-SMN1 monoclonal antibody |
Target Antigen | GM-Tg-g-T71907-Ag | SMN1 protein |
ORF Viral Vector | pGMLV001700 | Human SMN1 Lentivirus plasmid |
ORF Viral Vector | pGMLP000812 | Human SMN1 Lentivirus plasmid |
ORF Viral Vector | pGMLP000891 | Human SMN2 Lentivirus plasmid |
ORF Viral Vector | vGMLV001700 | Human SMN1 Lentivirus particle |
ORF Viral Vector | vGMLP000812 | Human SMN1 Lentivirus particle |
ORF Viral Vector | vGMLP000891 | Human SMN2 Lentivirus particle |
Target information
Target ID | GM-T71907 |
Target Name | SMN1 |
Gene ID | 6606, 677703 |
Gene Symbol and Synonyms | BCD541,GEMIN1,SMA,SMA1,SMA2,SMA3,SMA4,SMA@,SMN,SMN1,SMNT,T-BCD541,TDRD16A |
Uniprot Accession | Q16637 |
Uniprot Entry Name | SMN_HUMAN |
Protein Sub-location | Introcelluar Protein |
Category | Therapeutics Target |
Disease | Not Available |
Gene Ensembl | ENSG00000172062 |
Target Classification | Not Available |
This gene is part of a 500 kb inverted duplication on chromosome 5q13. This duplicated region contains at least four genes and repetitive elements which make it prone to rearrangements and deletions. The repetitiveness and complexity of the sequence have also caused difficulty in determining the organization of this genomic region. The telomeric and centromeric copies of this gene are nearly identical and encode the same protein. However, mutations in this gene, the telomeric copy, are associated with spinal muscular atrophy; mutations in the centromeric copy do not lead to disease. The centromeric copy may be a modifier of disease caused by mutation in the telomeric copy. The critical sequence difference between the two genes is a single nucleotide in exon 7, which is thought to be an exon splice enhancer. Note that the nine exons of both the telomeric and centromeric copies are designated historically as exon 1, 2a, 2b, and 3-8. It is thought that gene conversion events may involve the two genes, leading to varying copy numbers of each gene. The protein encoded by this gene localizes to both the cytoplasm and the nucleus. Within the nucleus, the protein localizes to subnuclear bodies called gems which are found near coiled bodies containing high concentrations of small ribonucleoproteins (snRNPs). This protein forms heteromeric complexes with proteins such as SIP1 and GEMIN4, and also interacts with several proteins known to be involved in the biogenesis of snRNPs, such as hnRNP U protein and the small nucleolar RNA binding protein. Multiple transcript variants encoding distinct isoforms have been described. [provided by RefSeq, Jul 2014]
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.