Human CAMP/CAP-18/ CAP18 ORF/cDNA clone-Lentivirus plasmid (NM_004345)
Pre-made Human CAMP/CAP-18/ CAP18 Lentiviral expression plasmid for CAMP lentivirus packaging, CAMP lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.
Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.
Go
to CAMP/CAP-18 products collection
>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product information
Catalog No. | Product Name | Plasmid Grade | Plasmid quantity |
---|---|---|---|
pGMLP000854 | Human CAMP Lentivirus plasmid | Research Grade | 10mg, 50mg, 100mg, 500mg, >1g |
GMP-like Grade | 10mg, 50mg, 100mg, 500mg, >1g | ||
High Quality (HQ) Grade | |||
Seed | 5ug |
Product Description
Catalog ID | pGMLP000854 |
Gene Name | CAMP |
Accession Number | NM_004345 |
Gene ID | 820 |
Species | Human |
Product Type | Lentivirus plasmid (overexpression) |
Insert Length | 522 bp |
Gene Alias | CAP-18, CAP18, CRAMP, FALL-39, FALL39, HSD26, LL37 |
Fluorescent Reporter | ZsGreen |
Mammalian Cell Selection | Puromyocin |
Fusion Tag | 3xflag (C-Terminal) |
Promoter | CMV |
Resistance | Amplicin |
Sequence | ATGGGGACCATGAAGACCCAAAGGGATGGCCACTCCCTGGGGCGGTGGTCACTGGTGCTCCTGCTGCTGGGCCTGGTGATGCCTCTGGCCATCATTGCCCAGGTCCTCAGCTACAAGGAAGCTGTGCTTCGTGCTATAGATGGCATCAACCAGCGGTCCTCGGATGCTAACCTCTACCGCCTCCTGGACCTGGACCCCAGGCCCACGATGGATGGGGACCCAGACACGCCAAAGCCTGTGAGCTTCACAGTGAAGGAGACAGTGTGCCCCAGGACGACACAGCAGTCACCAGAGGATTGTGACTTCAAGAAGGACGGGCTGGTGAAGCGGTGTATGGGGACAGTGACCCTCAACCAGGCCAGGGGCTCCTTTGACATCAGTTGTGATAAGGATAACAAGAGATTTGCCCTGCTGGGTGATTTCTTCCGGAAATCTAAAGAGAAGATTGGCAAAGAGTTTAAAAGAATTGTCCAGAGAATCAAGGATTTTTTGCGGAATCTTGTACCCAGGACAGAGTCCTAG |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
Category | Cat No. | Products Name |
---|---|---|
Target Antibody | GM-Tg-g-T34318-Ab | Anti-CAMP/ CAP-18/ CAP18 functional antibody |
Target Antigen | GM-Tg-g-T34318-Ag | CAMP protein |
ORF Viral Vector | pGMLP000854 | Human CAMP Lentivirus plasmid |
ORF Viral Vector | vGMLP000854 | Human CAMP Lentivirus particle |
Target information
Target ID | GM-T34318 |
Target Name | CAMP |
Gene ID | 820, 12796, 619186, 316010, 100533978, 442947 |
Gene Symbol and Synonyms | CAMP,CAP-18,CAP18,CLP,Cnlp,CRAMP,FALL-39,FALL39,HSD26,LL37,MCLP |
Uniprot Accession | P49913 |
Uniprot Entry Name | CAMP_HUMAN |
Protein Sub-location | Secreted Protein/Potential Cytokines |
Category | Therapeutics Target |
Disease | Cancer |
Gene Ensembl | ENSG00000164047 |
Target Classification | Tumor-associated antigen (TAA) |
This gene encodes a member of an antimicrobial peptide family, characterized by a highly conserved N-terminal signal peptide containing a cathelin domain and a structurally variable cationic antimicrobial peptide, which is produced by extracellular proteolysis from the C-terminus. The protein plays an important role in innate immunity defense against viruses. In addition to its antibacterial, antifungal, and antiviral activities, the encoded protein functions in cell chemotaxis, immune mediator induction, and inflammatory response regulation. [provided by RefSeq, Sep 2021]
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.