Human CAMP/CAP-18/ CAP18 ORF/cDNA clone-Lentivirus plasmid (NM_004345)

Pre-made Human CAMP/CAP-18/ CAP18 Lentiviral expression plasmid for CAMP lentivirus packaging, CAMP lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.

Target products collectionGo to CAMP/CAP-18 products collection >>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)



Product information

Catalog No. Product Name Plasmid Grade Plasmid quantity
pGMLP000854 Human CAMP Lentivirus plasmid Research Grade 10mg, 50mg, 100mg, 500mg, >1g
GMP-like Grade 10mg, 50mg, 100mg, 500mg, >1g
High Quality (HQ) Grade
Seed 5ug


Product Description

Catalog ID pGMLP000854
Gene Name CAMP
Accession Number NM_004345
Gene ID 820
Species Human
Product Type Lentivirus plasmid (overexpression)
Insert Length 522 bp
Gene Alias CAP-18, CAP18, CRAMP, FALL-39, FALL39, HSD26, LL37
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
Sequence ATGGGGACCATGAAGACCCAAAGGGATGGCCACTCCCTGGGGCGGTGGTCACTGGTGCTCCTGCTGCTGGGCCTGGTGATGCCTCTGGCCATCATTGCCCAGGTCCTCAGCTACAAGGAAGCTGTGCTTCGTGCTATAGATGGCATCAACCAGCGGTCCTCGGATGCTAACCTCTACCGCCTCCTGGACCTGGACCCCAGGCCCACGATGGATGGGGACCCAGACACGCCAAAGCCTGTGAGCTTCACAGTGAAGGAGACAGTGTGCCCCAGGACGACACAGCAGTCACCAGAGGATTGTGACTTCAAGAAGGACGGGCTGGTGAAGCGGTGTATGGGGACAGTGACCCTCAACCAGGCCAGGGGCTCCTTTGACATCAGTTGTGATAAGGATAACAAGAGATTTGCCCTGCTGGGTGATTTCTTCCGGAAATCTAAAGAGAAGATTGGCAAAGAGTTTAAAAGAATTGTCCAGAGAATCAAGGATTTTTTGCGGAATCTTGTACCCAGGACAGAGTCCTAG

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-T34318-Ab Anti-CAMP/ CAP-18/ CAP18 functional antibody
    Target Antigen GM-Tg-g-T34318-Ag CAMP protein
    ORF Viral Vector pGMLP000854 Human CAMP Lentivirus plasmid
    ORF Viral Vector vGMLP000854 Human CAMP Lentivirus particle


    Target information

    Target ID GM-T34318
    Target Name CAMP
    Gene ID 820, 12796, 619186, 316010, 100533978, 442947
    Gene Symbol and Synonyms CAMP,CAP-18,CAP18,CLP,Cnlp,CRAMP,FALL-39,FALL39,HSD26,LL37,MCLP
    Uniprot Accession P49913
    Uniprot Entry Name CAMP_HUMAN
    Protein Sub-location Secreted Protein/Potential Cytokines
    Category Therapeutics Target
    Disease Cancer
    Gene Ensembl ENSG00000164047
    Target Classification Tumor-associated antigen (TAA)

    This gene encodes a member of an antimicrobial peptide family, characterized by a highly conserved N-terminal signal peptide containing a cathelin domain and a structurally variable cationic antimicrobial peptide, which is produced by extracellular proteolysis from the C-terminus. The protein plays an important role in innate immunity defense against viruses. In addition to its antibacterial, antifungal, and antiviral activities, the encoded protein functions in cell chemotaxis, immune mediator induction, and inflammatory response regulation. [provided by RefSeq, Sep 2021]



    About GMVC

    GDU



    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.