Human PMEPA1/STAG1/TMEPAI ORF/cDNA clone-Lentivirus plasmid (NM_020182)
Cat. No.: pGMLP000861
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days
Pre-made Human PMEPA1/STAG1/TMEPAI Lentiviral expression plasmid for PMEPA1 lentivirus packaging, PMEPA1 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.
Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.
Go to
PMEPA1/STAG1 products
collection>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product Description
Catalog ID | pGMLP000861 |
Gene Name | PMEPA1 |
Accession Number | NM_020182 |
Gene ID | 56937 |
Species | Human |
Product Type | Lentivirus plasmid (overexpression) |
Insert Length | 864 bp |
Gene Alias | STAG1,TMEPAI |
Fluorescent Reporter | ZsGreen |
Mammalian Cell Selection | Puromyocin |
Fusion Tag | 3xflag (C-Terminal) |
Promoter | CMV |
Resistance | Amplicin |
ORF Nucleotide Sequence | ATGCACCGCTTGATGGGGGTCAACAGCACCGCCGCCGCCGCCGCCGGGCAGCCCAATGTCTCCTGCACGTGCAACTGCAAACGCTCTTTGTTCCAGAGCATGGAGATCACGGAGCTGGAGTTTGTTCAGATCATCATCATCGTGGTGGTGATGATGGTGATGGTGGTGGTGATCACGTGCCTGCTGAGCCACTACAAGCTGTCTGCACGGTCCTTCATCAGCCGGCACAGCCAGGGGCGGAGGAGAGAAGATGCCCTGTCCTCAGAAGGATGCCTGTGGCCCTCGGAGAGCACAGTGTCAGGCAACGGAATCCCAGAGCCGCAGGTCTACGCCCCGCCTCGGCCCACCGACCGCCTGGCCGTGCCGCCCTTCGCCCAGCGGGAGCGCTTCCACCGCTTCCAGCCCACCTATCCGTACCTGCAGCACGAGATCGACCTGCCACCCACCATCTCGCTGTCAGACGGGGAGGAGCCCCCACCCTACCAGGGCCCCTGCACCCTCCAGCTTCGGGACCCCGAGCAGCAGCTGGAACTGAACCGGGAGTCGGTGCGCGCACCCCCAAACAGAACCATCTTCGACAGTGACCTGATGGATAGTGCCAGGCTGGGCGGCCCCTGCCCCCCCAGCAGTAACTCGGGCATCAGCGCCACGTGCTACGGCAGCGGCGGGCGCATGGAGGGGCCGCCGCCCACCTACAGCGAGGTCATCGGCCACTACCCGGGGTCCTCCTTCCAGCACCAGCAGAGCAGTGGGCCGCCCTCCTTGCTGGAGGGGACCCGGCTCCACCACACACACATCGCGCCCCTAGAGAGCGCAGCCATCTGGAGCAAAGAGAAGGATAAACAGAAAGGACACCCTCTCTAG |
ORF Protein Sequence | MHRLMGVNSTAAAAAGQPNVSCTCNCKRSLFQSMEITELEFVQIIIIVVVMMVMVVVITCLLSHYKLSARSFISRHSQGRRREDALSSEGCLWPSESTVSGNGIPEPQVYAPPRPTDRLAVPPFAQRERFHRFQPTYPYLQHEIDLPPTISLSDGEEPPPYQGPCTLQLRDPEQQLELNRESVRAPPNRTIFDSDLMDSARLGGPCPPSSNSGISATCYGSGGRMEGPPPTYSEVIGHYPGSSFQHQQSSGPPSLLEGTRLHHTHIAPLESAAIWSKEKDKQKGHPL |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
Category | Cat No. | Products Name |
---|---|---|
Target Antibody | GM-Tg-g-MP1394-Ab | Anti-PMEPA/ PMEPA1/ STAG1 monoclonal antibody |
Target Antigen | GM-Tg-g-MP1394-Ag | PMEPA1 VLP (virus-like particle) |
ORF Viral Vector | pGMLP000861 | Human PMEPA1 Lentivirus plasmid |
ORF Viral Vector | vGMLP000861 | Human PMEPA1 Lentivirus particle |
Target information
Target ID | GM-MP1394 |
Target Name | PMEPA1 |
Gene ID | 56937, 65112, 695968, 311676, 101093173, 485945, 617469, 100055800 |
Gene Symbol and Synonyms | 2210418I02Rik,Erg1.2,N4wbp4,PMEPA1,STAG1,TMEPAI |
Uniprot Accession | Q969W9 |
Uniprot Entry Name | PMEPA_HUMAN |
Protein Sub-location | Transmembrane Protein |
Category | Not Available |
Disease | Not Available |
Gene Ensembl | ENSG00000124225 |
Target Classification | Not Available |
This gene encodes a transmembrane protein that contains a Smad interacting motif (SIM). Expression of this gene is induced by androgens and transforming growth factor beta, and the encoded protein suppresses the androgen receptor and transforming growth factor beta signaling pathways though interactions with Smad proteins. Overexpression of this gene may play a role in multiple types of cancer. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Dec 2011]
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.