Human CCL27/ALP/ CTACK ORF/cDNA clone-Lentivirus plasmid (NM_006664)
Pre-made Human CCL27/ALP/ CTACK Lentiviral expression plasmid for CCL27 lentivirus packaging, CCL27 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.
Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.
Go
to CCL27/ALP products collection
>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product information
Catalog No. | Product Name | Plasmid Grade | Plasmid quantity |
---|---|---|---|
pGMLP000932 | Human CCL27 Lentivirus plasmid | Research Grade | 10mg, 50mg, 100mg, 500mg, >1g |
GMP-like Grade | 10mg, 50mg, 100mg, 500mg, >1g | ||
High Quality (HQ) Grade | |||
Seed | 5ug |
Product Description
Catalog ID | pGMLP000932 |
Gene Name | CCL27 |
Accession Number | NM_006664 |
Gene ID | 10850 |
Species | Human |
Product Type | Lentivirus plasmid (overexpression) |
Insert Length | 339 bp |
Gene Alias | ALP, CTACK, CTAK, ESKINE, ILC, PESKY, SCYA27 |
Fluorescent Reporter | ZsGreen |
Mammalian Cell Selection | Puromyocin |
Fusion Tag | 3xflag (C-Terminal) |
Promoter | CMV |
Resistance | Amplicin |
Sequence | ATGAAGGGGCCCCCAACCTTCTGCAGCCTCCTGCTGCTGTCATTGCTCCTGAGCCCAGACCCTACAGCAGCATTCCTACTGCCACCCAGCACTGCCTGCTGTACTCAGCTCTACCGAAAGCCACTCTCAGACAAGCTACTGAGGAAGGTCATCCAGGTGGAACTGCAGGAGGCTGACGGGGACTGTCACCTCCAGGCTTTCGTGCTTCACCTGGCTCAACGCAGCATCTGCATCCACCCCCAGAACCCCAGCCTGTCACAGTGGTTTGAGCACCAAGAGAGAAAGCTCCATGGGACTCTGCCCAAGCTGAATTTTGGGATGCTAAGGAAAATGGGCTGA |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
Category | Cat No. | Products Name |
---|---|---|
Target Antibody | GM-Tg-g-SE0747-Ab | Anti-CCL27/ ALP/ CTACK functional antibody |
Target Antigen | GM-Tg-g-SE0747-Ag | CCL27 protein |
Cytokine | cks-Tg-g-GM-SE0747 | chemokine (C-C motif) ligand 27 (CCL27) protein & antibody |
ORF Viral Vector | pGMLP000932 | Human CCL27 Lentivirus plasmid |
ORF Viral Vector | vGMLP000932 | Human CCL27 Lentivirus particle |
Target information
Target ID | GM-SE0747 |
Target Name | CCL27 |
Gene ID | 10850, 20301, 574220, 101086511, 445454, 101902682, 102147669 |
Gene Symbol and Synonyms | ALP,CCL27,Ccl27a,CTACK,CTAK,ESKINE,ILC,PESKY,SCYA27,Scya27a |
Uniprot Accession | Q9Y4X3 |
Uniprot Entry Name | CCL27_HUMAN |
Protein Sub-location | Secreted Protein/Potential Cytokines |
Category | Cytokine Target |
Disease | Not Available |
Gene Ensembl | ENSG00000213927 |
Target Classification | Not Available |
This gene is one of several CC cytokine genes clustered on the p-arm of chromosome 9. Cytokines are a family of secreted proteins involved in immunoregulatory and inflammatory processes. The CC cytokines are proteins characterized by two adjacent cysteines. The protein encoded by this gene is chemotactic for skin-associated memory T lymphocytes. This cytokine may also play a role in mediating homing of lymphocytes to cutaneous sites. It specifically binds to chemokine receptor 10 (CCR10). Studies of a similar murine protein indicate that these protein-receptor interactions have a pivotal role in T cell-mediated skin inflammation. [provided by RefSeq, Sep 2014]
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.