Human CCL27/ALP/ CTACK ORF/cDNA clone-Lentivirus plasmid (NM_006664)

Pre-made Human CCL27/ALP/ CTACK Lentiviral expression plasmid for CCL27 lentivirus packaging, CCL27 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.

Target products collectionGo to CCL27/ALP products collection >>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)



Product information

Catalog No. Product Name Plasmid Grade Plasmid quantity
pGMLP000932 Human CCL27 Lentivirus plasmid Research Grade 10mg, 50mg, 100mg, 500mg, >1g
GMP-like Grade 10mg, 50mg, 100mg, 500mg, >1g
High Quality (HQ) Grade
Seed 5ug


Product Description

Catalog ID pGMLP000932
Gene Name CCL27
Accession Number NM_006664
Gene ID 10850
Species Human
Product Type Lentivirus plasmid (overexpression)
Insert Length 339 bp
Gene Alias ALP, CTACK, CTAK, ESKINE, ILC, PESKY, SCYA27
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
Sequence ATGAAGGGGCCCCCAACCTTCTGCAGCCTCCTGCTGCTGTCATTGCTCCTGAGCCCAGACCCTACAGCAGCATTCCTACTGCCACCCAGCACTGCCTGCTGTACTCAGCTCTACCGAAAGCCACTCTCAGACAAGCTACTGAGGAAGGTCATCCAGGTGGAACTGCAGGAGGCTGACGGGGACTGTCACCTCCAGGCTTTCGTGCTTCACCTGGCTCAACGCAGCATCTGCATCCACCCCCAGAACCCCAGCCTGTCACAGTGGTTTGAGCACCAAGAGAGAAAGCTCCATGGGACTCTGCCCAAGCTGAATTTTGGGATGCTAAGGAAAATGGGCTGA

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-SE0747-Ab Anti-CCL27/ ALP/ CTACK functional antibody
    Target Antigen GM-Tg-g-SE0747-Ag CCL27 protein
    Cytokine cks-Tg-g-GM-SE0747 chemokine (C-C motif) ligand 27 (CCL27) protein & antibody
    ORF Viral Vector pGMLP000932 Human CCL27 Lentivirus plasmid
    ORF Viral Vector vGMLP000932 Human CCL27 Lentivirus particle


    Target information

    Target ID GM-SE0747
    Target Name CCL27
    Gene ID 10850, 20301, 574220, 101086511, 445454, 101902682, 102147669
    Gene Symbol and Synonyms ALP,CCL27,Ccl27a,CTACK,CTAK,ESKINE,ILC,PESKY,SCYA27,Scya27a
    Uniprot Accession Q9Y4X3
    Uniprot Entry Name CCL27_HUMAN
    Protein Sub-location Secreted Protein/Potential Cytokines
    Category Cytokine Target
    Disease Not Available
    Gene Ensembl ENSG00000213927
    Target Classification Not Available

    This gene is one of several CC cytokine genes clustered on the p-arm of chromosome 9. Cytokines are a family of secreted proteins involved in immunoregulatory and inflammatory processes. The CC cytokines are proteins characterized by two adjacent cysteines. The protein encoded by this gene is chemotactic for skin-associated memory T lymphocytes. This cytokine may also play a role in mediating homing of lymphocytes to cutaneous sites. It specifically binds to chemokine receptor 10 (CCR10). Studies of a similar murine protein indicate that these protein-receptor interactions have a pivotal role in T cell-mediated skin inflammation. [provided by RefSeq, Sep 2014]



    About GMVC

    GDU



    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.