Human TSPAN9/NET-5/NET5 ORF/cDNA clone-Lentivirus plasmid (NM_006675)

Cat. No.: pGMLP000941
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days

Pre-made Human TSPAN9/NET-5/NET5 Lentiviral expression plasmid for TSPAN9 lentivirus packaging, TSPAN9 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.

pdf Datasheet
pdf MSDS
pdf Terms of Use
Target products collection

Go to TSPAN9/NET-5 products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Purchase
Total Price: $480
Shipping fee: Limited-time free
For payment issues, contact us.


Product Description

Catalog ID pGMLP000941
Gene Name TSPAN9
Accession Number NM_006675
Gene ID 10867
Species Human
Product Type Lentivirus plasmid (overexpression)
Insert Length 720 bp
Gene Alias NET-5,NET5,PP1057
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGGCCAGGGGCTGCCTCTGCTGCTTGAAGTACATGATGTTCCTCTTCAATTTGATATTCTGGCTCTGTGGCTGTGGGCTGCTGGGAGTGGGCATCTGGCTCTCCGTGTCCCAAGGCAACTTTGCCACCTTCTCCCCCAGCTTCCCTTCGTTGTCTGCAGCCAACCTGGTCATTGCCATAGGCACCATTGTCATGGTGACGGGCTTCCTCGGCTGCCTGGGGGCCATCAAGGAAAACAAGTGCCTCCTCCTCAGCTTTTTCATCGTCCTGTTGGTCATCCTCCTAGCAGAGCTGATCTTACTCATCCTCTTCTTTGTCTACATGGACAAGGTGAACGAGAACGCCAAGAAGGACCTGAAGGAAGGCCTGCTGCTGTACCACACCGAGAACAACGTGGGGCTGAAGAACGCCTGGAACATCATCCAGGCTGAGATGCGATGCTGTGGTGTCACTGACTACACAGACTGGTACCCAGTGCTGGGGGAGAACACGGTTCCCGACCGCTGCTGCATGGAGAACTCCCAGGGCTGCGGGCGCAACGCCACCACGCCTTTGTGGAGAACGGGCTGCTATGAAAAGGTGAAGATGTGGTTCGATGACAATAAGCACGTGCTGGGCACGGTGGGGATGTGCATCCTCATCATGCAGATCCTGGGCATGGCCTTCTCCATGACCCTCTTCCAGCACATCCACCGGACTGGTAAGAAGTACGACGCATGA
ORF Protein Sequence MARGCLCCLKYMMFLFNLIFWLCGCGLLGVGIWLSVSQGNFATFSPSFPSLSAANLVIAIGTIVMVTGFLGCLGAIKENKCLLLSFFIVLLVILLAELILLILFFVYMDKVNENAKKDLKEGLLLYHTENNVGLKNAWNIIQAEMRCCGVTDYTDWYPVLGENTVPDRCCMENSQGCGRNATTPLWRTGCYEKVKMWFDDNKHVLGTVGMCILIMQILGMAFSMTLFQHIHRTGKKYDA

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-MP1887-Ab Anti-TSN9/ TSPAN9/ NET-5 monoclonal antibody
    Target Antigen GM-Tg-g-MP1887-Ag TSPAN9 VLP (virus-like particle)
    ORF Viral Vector pGMLP000941 Human TSPAN9 Lentivirus plasmid
    ORF Viral Vector vGMLP000941 Human TSPAN9 Lentivirus particle


    Target information

    Target ID GM-MP1887
    Target Name TSPAN9
    Gene ID 10867, 109246, 721790, 312728, 101090195, 612996, 540132, 100050926
    Gene Symbol and Synonyms 6720474K14Rik,9430079M16Rik,NET-5,NET5,PP1057,RGD1304740,Tspan-9,TSPAN9
    Uniprot Accession O75954
    Uniprot Entry Name TSN9_HUMAN
    Protein Sub-location Transmembrane Protein
    Category Not Available
    Disease Not Available
    Gene Ensembl ENSG00000011105
    Target Classification Not Available

    The protein encoded by this gene is a member of the transmembrane 4 superfamily, also known as the tetraspanin family. Most of these members are cell-surface proteins that are characterized by the presence of four hydrophobic domains. The proteins mediate signal transduction events that play a role in the regulation of cell development, activation, growth and motility. Alternatively spliced transcripts encoding the same protein have been identified. [provided by RefSeq, Nov 2009]



    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.