Human ASRGL1/ALP/ ALP1 ORF/cDNA clone-Lentivirus plasmid (NM_025080)

Pre-made Human ASRGL1/ALP/ ALP1 Lentiviral expression plasmid for ASRGL1 lentivirus packaging, ASRGL1 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.

Target products collectionGo to ASRGL1/ALP products collection >>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)



Product information

Catalog No. Product Name Plasmid Grade Plasmid quantity
pGMLP000944 Human ASRGL1 Lentivirus plasmid Research Grade 10mg, 50mg, 100mg, 500mg, >1g
GMP-like Grade 10mg, 50mg, 100mg, 500mg, >1g
High Quality (HQ) Grade
Seed 5ug


Product Description

Catalog ID pGMLP000944
Gene Name ASRGL1
Accession Number NM_025080
Gene ID 80150
Species Human
Product Type Lentivirus plasmid (overexpression)
Insert Length 927 bp
Gene Alias ALP, ALP1, CRASH
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
Sequence ATGAATCCCATCGTAGTGGTCCACGGCGGCGGAGCCGGTCCCATCTCCAAGGATCGGAAGGAGCGAGTGCACCAGGGCATGGTCAGAGCCGCCACCGTGGGCTACGGCATCCTCCGGGAGGGCGGGAGCGCCGTGGATGCCGTAGAGGGAGCTGTCGTCGCCCTGGAAGACGATCCCGAGTTCAACGCAGGTTGTGGGTCTGTCTTGAACACAAATGGTGAGGTTGAAATGGATGCTAGTATCATGGATGGAAAAGACCTGTCTGCAGGAGCAGTGTCCGCAGTCCAGTGTATAGCAAATCCCATTAAACTTGCTCGGCTTGTCATGGAAAAGACACCTCATTGCTTTCTGACTGACCAAGGCGCAGCGCAGTTTGCAGCAGCTATGGGGGTTCCAGAGATTCCTGGAGAAAAACTGGTGACAGAGAGAAACAAAAAGCGCCTGGAAAAAGAGAAGCATGAAAAAGGTGCTCAGAAAACAGATTGTCAAAAAAACTTGGGAACCGTGGGTGCTGTTGCCTTGGACTGCAAAGGGAATGTAGCCTACGCAACCTCCACAGGCGGTATCGTTAATAAAATGGTCGGCCGCGTTGGGGACTCACCGTGTCTAGGAGCTGGAGGTTATGCCGACAATGACATCGGAGCCGTCTCAACCACAGGGCATGGGGAAAGCATCCTGAAGGTGAACCTGGCTAGACTCACCCTGTTCCACATAGAACAAGGAAAGACGGTAGAAGAGGCTGCGGACCTATCGTTGGGTTATATGAAGTCAAGGGTTAAAGGTTTAGGTGGCCTCATCGTGGTTAGCAAAACAGGAGACTGGGTGGCAAAGTGGACCTCCACCTCCATGCCCTGGGCAGCCGCCAAGGACGGCAAGCTGCACTTCGGAATTGATCCTGACGATACTACTATCACCGACCTTCCCTAA

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-T78277-Ab Anti-ASRGL1 monoclonal antibody
    Target Antigen GM-Tg-g-T78277-Ag ASRGL1 protein
    ORF Viral Vector pGMLP000944 Human ASRGL1 Lentivirus plasmid
    ORF Viral Vector vGMLP000944 Human ASRGL1 Lentivirus particle


    Target information

    Target ID GM-T78277
    Target Name ASRGL1
    Gene ID 80150, 66514, 718871, 246307, 101087268, 483789, 767970
    Gene Symbol and Synonyms 2410004D18Rik,ALP,ALP1,ASRGL1,CRASH,Gliap,Hiob2
    Uniprot Accession Q7L266
    Uniprot Entry Name ASGL1_HUMAN
    Protein Sub-location Introcelluar Protein
    Category Therapeutics Target
    Disease Not Available
    Gene Ensembl ENSG00000162174
    Target Classification Not Available

    Enables asparaginase activity and beta-aspartyl-peptidase activity. Involved in asparagine catabolic process via L-aspartate. Located in cytoplasm. [provided by Alliance of Genome Resources, Apr 2022]



    About GMVC

    GDU



    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.