Human HSPB6/HEL55/ Hsp20 ORF/cDNA clone-Lentivirus plasmid (NM_144617)

Pre-made Human HSPB6/HEL55/ Hsp20 Lentiviral expression plasmid for HSPB6 lentivirus packaging, HSPB6 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.

Target products collectionGo to HSPB6/HEL55 products collection >>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)



Product information

Catalog No. Product Name Plasmid Grade Plasmid quantity
pGMLP000971 Human HSPB6 Lentivirus plasmid Research Grade 10mg, 50mg, 100mg, 500mg, >1g
GMP-like Grade 10mg, 50mg, 100mg, 500mg, >1g
High Quality (HQ) Grade
Seed 5ug


Product Description

Catalog ID pGMLP000971
Gene Name HSPB6
Accession Number NM_144617
Gene ID 126393
Species Human
Product Type Lentivirus plasmid (overexpression)
Insert Length 483 bp
Gene Alias HEL55, Hsp20, PPP1R91
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
Sequence ATGGAGATCCCTGTGCCTGTGCAGCCGTCTTGGCTGCGCCGCGCCTCGGCCCCGTTGCCCGGACTTTCGGCGCCCGGACGCCTCTTTGACCAGCGCTTCGGCGAGGGGCTGCTGGAGGCCGAGCTGGCTGCGCTCTGCCCCACCACGCTCGCCCCCTACTACCTGCGCGCACCCAGCGTGGCGCTGCCCGTCGCCCAGGTGCCGACGGACCCCGGCCACTTTTCGGTGCTGCTAGACGTGAAGCACTTCTCGCCGGAGGAAATTGCTGTCAAGGTGGTGGGCGAACACGTGGAGGTGCACGCGCGCCACGAGGAGCGCCCGGATGAGCACGGATTCGTCGCGCGCGAGTTCCACCGTCGCTACCGCCTGCCGCCTGGCGTGGATCCGGCTGCCGTGACGTCCGCGCTGTCCCCCGAGGGCGTCCTGTCCATCCAGGCCGCACCAGCGTCGGCCCAGGCCCCACCGCCAGCCGCAGCCAAGTAG

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-SE1397-Ab Anti-HSPB6/ HEL55/ Hsp20 functional antibody
    Target Antigen GM-Tg-g-SE1397-Ag HSPB6 protein
    ORF Viral Vector pGMLP000971 Human HSPB6 Lentivirus plasmid
    ORF Viral Vector vGMLP000971 Human HSPB6 Lentivirus particle


    Target information

    Target ID GM-SE1397
    Target Name HSPB6
    Gene ID 126393, 243912, 710760, 192245, 101098270, 484574, 534551, 100146605
    Gene Symbol and Synonyms Gm479,HEL55,Hsp20,HSPB6,p20,PPP1R91
    Uniprot Accession O14558
    Uniprot Entry Name HSPB6_HUMAN
    Protein Sub-location Secreted Protein/Potential Cytokines
    Category Not Available
    Disease Prostate Cancer
    Gene Ensembl ENSG00000004776
    Target Classification Not Available

    This locus encodes a heat shock protein. The encoded protein likely plays a role in smooth muscle relaxation. [provided by RefSeq, Jan 2012]



    About GMVC

    GDU



    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.