Human CAPNS1/CALPAIN4/CANP ORF/cDNA clone-Lentivirus plasmid (NM_001003962)

Cat. No.: pGMLP000973
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days

Pre-made Human CAPNS1/CALPAIN4/CANP Lentiviral expression plasmid for CAPNS1 lentivirus packaging, CAPNS1 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.


Target products collection

Go to CAPNS1/CALPAIN4 products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Purchase
Total Price: $501.75
Shipping fee: Limited-time free
For payment issues, contact us.


Product Description

Catalog ID pGMLP000973
Gene Name CAPNS1
Accession Number NM_001003962
Gene ID 826
Species Human
Product Type Lentivirus plasmid (overexpression)
Insert Length 807 bp
Gene Alias CALPAIN4,CANP,CANPS,CAPN4,CDPS,CSS1
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGTTCCTGGTTAACTCGTTCTTGAAGGGCGGCGGCGGCGGCGGCGGGGGAGGCGGGGGCCTGGGTGGGGGCCTGGGAAATGTGCTTGGAGGCCTGATCAGCGGGGCCGGGGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGTGGTGGAGGCGGCGGTGGCGGTGGAACGGCCATGCGCATCCTAGGCGGAGTCATCAGCGCCATCAGCGAGGCGGCTGCGCAGTACAACCCGGAGCCCCCGCCCCCACGCACACATTACTCCAACATTGAGGCCAACGAGAGTGAGGAGGTCCGGCAGTTCCGGAGACTCTTTGCCCAGCTGGCTGGAGATGACATGGAGGTCAGCGCCACAGAACTCATGAACATTCTCAATAAGGTTGTGACACGACACCCTGATCTGAAGACTGATGGTTTTGGCATTGACACATGTCGCAGCATGGTGGCCGTGATGGATAGCGACACCACAGGCAAGCTGGGCTTTGAGGAATTCAAGTACTTGTGGAACAACATCAAAAGGTGGCAGGCCATATACAAACAGTTCGACACTGACCGATCAGGGACCATTTGCAGTAGTGAACTCCCAGGTGCCTTTGAGGCAGCAGGGTTCCACCTGAATGAGCATCTCTATAACATGATCATCCGACGCTACTCAGATGAAAGTGGGAACATGGATTTTGACAACTTCATCAGCTGCTTGGTCAGGCTGGACGCCATGTTCCGTGCCTTCAAATCTCTTGACAAAGATGGCACTGGACAAATCCAGGTGAACATCCAGGAGTGGCTGCAGCTGACTATGTATTCCTGA
ORF Protein Sequence MFLVNSFLKGGGGGGGGGGGLGGGLGNVLGGLISGAGGGGGGGGGGGGGGGGGGGGTAMRILGGVISAISEAAAQYNPEPPPPRTHYSNIEANESEEVRQFRRLFAQLAGDDMEVSATELMNILNKVVTRHPDLKTDGFGIDTCRSMVAVMDSDTTGKLGFEEFKYLWNNIKRWQAIYKQFDTDRSGTICSSELPGAFEAAGFHLNEHLYNMIIRRYSDESGNMDFDNFISCLVRLDAMFRAFKSLDKDGTGQIQVNIQEWLQLTMYS

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-MP0180-Ab Anti-CPNS1/ CAPNS1/ CALPAIN4 monoclonal antibody
    Target Antigen GM-Tg-g-MP0180-Ag CAPNS1 VLP (virus-like particle)
    ORF Viral Vector pGMLP000973 Human CAPNS1 Lentivirus plasmid
    ORF Viral Vector vGMLP000973 Human CAPNS1 Lentivirus particle


    Target information

    Target ID GM-MP0180
    Target Name CAPNS1
    Gene ID 826, 12336, 712561, 29156, 101099260, 611746, 281664, 100051987
    Gene Symbol and Synonyms CALPAIN4,CANP,CANPS,Capa-4,Capa4,CAPN4,CAPNS1,CDPS,CSS1,D7Ertd146e
    Uniprot Accession P04632
    Uniprot Entry Name CPNS1_HUMAN
    Protein Sub-location Transmembrane Protein
    Category Not Available
    Disease Lung Cancer
    Gene Ensembl ENSG00000126247
    Target Classification Not Available

    This gene is a member of the calpain small subunit family. Calpains are calcium-dependent cysteine proteinases that are widely distributed in mammalian cells. Calpains operate as heterodimers, comprising a specific large catalytic subunit (calpain 1 subunit in Calpain I, and calpain 2 subunit in Calpain II), and a common small regulatory subunit encoded by this gene. This encoded protein is essential for the stability and function of both calpain heterodimers, whose proteolytic activities influence various cellular functions including apoptosis, proliferation, migration, adhesion, and autophagy. Calpains have been implicated in neurodegenerative processes, such as myotonic dystrophy. A pseudogene of this gene has been defined on chromosome 1. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2014]



    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.