Human CAPNS1/CALPAIN4/CANP ORF/cDNA clone-Lentivirus plasmid (NM_001003962)
Cat. No.: pGMLP000973
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days
Pre-made Human CAPNS1/CALPAIN4/CANP Lentiviral expression plasmid for CAPNS1 lentivirus packaging, CAPNS1 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.
Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.
Go to
CAPNS1/CALPAIN4 products
collection>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product Description
Catalog ID | pGMLP000973 |
Gene Name | CAPNS1 |
Accession Number | NM_001003962 |
Gene ID | 826 |
Species | Human |
Product Type | Lentivirus plasmid (overexpression) |
Insert Length | 807 bp |
Gene Alias | CALPAIN4,CANP,CANPS,CAPN4,CDPS,CSS1 |
Fluorescent Reporter | ZsGreen |
Mammalian Cell Selection | Puromyocin |
Fusion Tag | 3xflag (C-Terminal) |
Promoter | CMV |
Resistance | Amplicin |
ORF Nucleotide Sequence | ATGTTCCTGGTTAACTCGTTCTTGAAGGGCGGCGGCGGCGGCGGCGGGGGAGGCGGGGGCCTGGGTGGGGGCCTGGGAAATGTGCTTGGAGGCCTGATCAGCGGGGCCGGGGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGTGGTGGAGGCGGCGGTGGCGGTGGAACGGCCATGCGCATCCTAGGCGGAGTCATCAGCGCCATCAGCGAGGCGGCTGCGCAGTACAACCCGGAGCCCCCGCCCCCACGCACACATTACTCCAACATTGAGGCCAACGAGAGTGAGGAGGTCCGGCAGTTCCGGAGACTCTTTGCCCAGCTGGCTGGAGATGACATGGAGGTCAGCGCCACAGAACTCATGAACATTCTCAATAAGGTTGTGACACGACACCCTGATCTGAAGACTGATGGTTTTGGCATTGACACATGTCGCAGCATGGTGGCCGTGATGGATAGCGACACCACAGGCAAGCTGGGCTTTGAGGAATTCAAGTACTTGTGGAACAACATCAAAAGGTGGCAGGCCATATACAAACAGTTCGACACTGACCGATCAGGGACCATTTGCAGTAGTGAACTCCCAGGTGCCTTTGAGGCAGCAGGGTTCCACCTGAATGAGCATCTCTATAACATGATCATCCGACGCTACTCAGATGAAAGTGGGAACATGGATTTTGACAACTTCATCAGCTGCTTGGTCAGGCTGGACGCCATGTTCCGTGCCTTCAAATCTCTTGACAAAGATGGCACTGGACAAATCCAGGTGAACATCCAGGAGTGGCTGCAGCTGACTATGTATTCCTGA |
ORF Protein Sequence | MFLVNSFLKGGGGGGGGGGGLGGGLGNVLGGLISGAGGGGGGGGGGGGGGGGGGGGTAMRILGGVISAISEAAAQYNPEPPPPRTHYSNIEANESEEVRQFRRLFAQLAGDDMEVSATELMNILNKVVTRHPDLKTDGFGIDTCRSMVAVMDSDTTGKLGFEEFKYLWNNIKRWQAIYKQFDTDRSGTICSSELPGAFEAAGFHLNEHLYNMIIRRYSDESGNMDFDNFISCLVRLDAMFRAFKSLDKDGTGQIQVNIQEWLQLTMYS |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
Category | Cat No. | Products Name |
---|---|---|
Target Antibody | GM-Tg-g-MP0180-Ab | Anti-CPNS1/ CAPNS1/ CALPAIN4 monoclonal antibody |
Target Antigen | GM-Tg-g-MP0180-Ag | CAPNS1 VLP (virus-like particle) |
ORF Viral Vector | pGMLP000973 | Human CAPNS1 Lentivirus plasmid |
ORF Viral Vector | vGMLP000973 | Human CAPNS1 Lentivirus particle |
Target information
Target ID | GM-MP0180 |
Target Name | CAPNS1 |
Gene ID | 826, 12336, 712561, 29156, 101099260, 611746, 281664, 100051987 |
Gene Symbol and Synonyms | CALPAIN4,CANP,CANPS,Capa-4,Capa4,CAPN4,CAPNS1,CDPS,CSS1,D7Ertd146e |
Uniprot Accession | P04632 |
Uniprot Entry Name | CPNS1_HUMAN |
Protein Sub-location | Transmembrane Protein |
Category | Not Available |
Disease | Lung Cancer |
Gene Ensembl | ENSG00000126247 |
Target Classification | Not Available |
This gene is a member of the calpain small subunit family. Calpains are calcium-dependent cysteine proteinases that are widely distributed in mammalian cells. Calpains operate as heterodimers, comprising a specific large catalytic subunit (calpain 1 subunit in Calpain I, and calpain 2 subunit in Calpain II), and a common small regulatory subunit encoded by this gene. This encoded protein is essential for the stability and function of both calpain heterodimers, whose proteolytic activities influence various cellular functions including apoptosis, proliferation, migration, adhesion, and autophagy. Calpains have been implicated in neurodegenerative processes, such as myotonic dystrophy. A pseudogene of this gene has been defined on chromosome 1. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2014]
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.