Human CD47/IAP/MER6 ORF/cDNA clone-Lentivirus plasmid (NM_001777)

Cat. No.: pGMLP001005
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days

Pre-made Human CD47/IAP/MER6 Lentiviral expression plasmid for CD47 lentivirus packaging, CD47 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.


Target products collection

Go to CD47/IAP products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Purchase
Total Price: $543
Shipping fee: Limited-time free
For payment issues, contact us.


Product Description

Catalog ID pGMLP001005
Gene Name CD47
Accession Number NM_001777
Gene ID 961
Species Human
Product Type Lentivirus plasmid (overexpression)
Insert Length 972 bp
Gene Alias IAP,MER6,OA3
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGTGGCCCCTGGTAGCGGCGCTGTTGCTGGGCTCGGCGTGCTGCGGATCAGCTCAGCTACTATTTAATAAAACAAAATCTGTAGAATTCACGTTTTGTAATGACACTGTCGTCATTCCATGCTTTGTTACTAATATGGAGGCACAAAACACTACTGAAGTATACGTAAAGTGGAAATTTAAAGGAAGAGATATTTACACCTTTGATGGAGCTCTAAACAAGTCCACTGTCCCCACTGACTTTAGTAGTGCAAAAATTGAAGTCTCACAATTACTAAAAGGAGATGCCTCTTTGAAGATGGATAAGAGTGATGCTGTCTCACACACAGGAAACTACACTTGTGAAGTAACAGAATTAACCAGAGAAGGTGAAACGATCATCGAGCTAAAATATCGTGTTGTTTCATGGTTTTCTCCAAATGAAAATATTCTTATTGTTATTTTCCCAATTTTTGCTATACTCCTGTTCTGGGGACAGTTTGGTATTAAAACACTTAAATATAGATCCGGTGGTATGGATGAGAAAACAATTGCTTTACTTGTTGCTGGACTAGTGATCACTGTCATTGTCATTGTTGGAGCCATTCTTTTCGTCCCAGGTGAATATTCATTAAAGAATGCTACTGGCCTTGGTTTAATTGTGACTTCTACAGGGATATTAATATTACTTCACTACTATGTGTTTAGTACAGCGATTGGATTAACCTCCTTCGTCATTGCCATATTGGTTATTCAGGTGATAGCCTATATCCTCGCTGTGGTTGGACTGAGTCTCTGTATTGCGGCGTGTATACCAATGCATGGCCCTCTTCTGATTTCAGGTTTGAGTATCTTAGCTCTAGCACAATTACTTGGACTAGTTTATATGAAATTTGTGGCTTCCAATCAGAAGACTATACAACCTCCTAGGAAAGCTGTAGAGGAACCCCTTAATGCATTCAAAGAATCAAAAGGAATGATGAATGATGAATAA
ORF Protein Sequence MWPLVAALLLGSACCGSAQLLFNKTKSVEFTFCNDTVVIPCFVTNMEAQNTTEVYVKWKFKGRDIYTFDGALNKSTVPTDFSSAKIEVSQLLKGDASLKMDKSDAVSHTGNYTCEVTELTREGETIIELKYRVVSWFSPNENILIVIFPIFAILLFWGQFGIKTLKYRSGGMDEKTIALLVAGLVITVIVIVGAILFVPGEYSLKNATGLGLIVTSTGILILLHYYVFSTAIGLTSFVIAILVIQVIAYILAVVGLSLCIAACIPMHGPLLISGLSILALAQLLGLVYMKFVASNQKTIQPPRKAVEEPLNAFKESKGMMNDE

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Biosimilar GMP-Bios-ab-676 Pre-Made Ligufalimab biosimilar, Whole mAb, Anti-CD47 Antibody: Anti-IAP/OA3/MER6 therapeutic antibody
    Biosimilar GMP-Bios-INN-937 Pre-Made Ontorpacept Biosimilar, Fusion Protein targeting CD47 fused with human IGHG1 Fc (Fragment constant): Recombinant therapeutic protein targeting IAP/MER6/OA3
    Biosimilar GMP-Bios-ab-306 Pre-Made Letaplimab biosimilar, Whole mAb, Anti-CD47 Antibody: Anti-IAP/OA3/MER6 therapeutic antibody
    Biosimilar GMP-Bios-ab-333 Pre-Made Magrolimab biosimilar, Whole mAb, Anti-CD47 Antibody: Anti-IAP/OA3/MER6 therapeutic antibody
    Biosimilar GMP-Bios-ab-603 Pre-Made Urabrelimab biosimilar, Whole mAb, Anti-CD47 Antibody: Anti-IAP/OA3/MER6 therapeutic antibody
    Biosimilar GMP-Bios-ab-693 Pre-Made Simridarlimab biosimilar, Whole mAb, Anti-CD47;CD274/PD-L1 Antibody: Anti-IAP/OA3/MER6;B7-H/B7H1/PD-L1/PDCD1L1/PDCD1LG1/PDL1/hPD-L1 therapeutic antibody
    Biosimilar GMP-Bios-ab-301 Pre-Made Lemzoparlimab biosimilar, Whole mAb, Anti-CD47 Antibody: Anti-IAP/OA3/MER6 therapeutic antibody
    Target Antibody GM-Tg-g-T97766-Ab Anti-CD47/ IAP/ MER6 monoclonal antibody
    Target Antigen GM-Tg-g-T97766-Ag CD47 VLP (virus-like particle)
    ORF Viral Vector pGMLP001005 Human CD47 Lentivirus plasmid
    ORF Viral Vector pGMLV001739 Human CD47 Lentivirus plasmid
    ORF Viral Vector vGMLP001005 Human CD47 Lentivirus particle
    ORF Viral Vector vGMLV001739 Human CD47 Lentivirus particle


    Target information

    Target ID GM-T97766
    Target Name CD47
    Gene ID 961, 16423, 704980, 101083027, 478552, 282661, 100071854
    Gene Symbol and Synonyms 9130415E20Rik,B430305P08Rik,CD47,IAP,Itgp,MER6,OA3
    Uniprot Accession Q08722
    Uniprot Entry Name CD47_HUMAN
    Protein Sub-location Transmembrane Protein
    Category Therapeutics Target, Immuno-oncology Target, INN Index
    Disease Cancer
    Gene Ensembl ENSG00000196776
    Target Classification Checkpoint-Immuno Oncology, Tumor-associated antigen (TAA)

    This gene encodes a membrane protein, which is involved in the increase in intracellular calcium concentration that occurs upon cell adhesion to extracellular matrix. The encoded protein is also a receptor for the C-terminal cell binding domain of thrombospondin, and it may play a role in membrane transport and signal transduction. This gene has broad tissue distribution, and is reduced in expression on Rh erythrocytes. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Jul 2010]



    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.