Human SERPING1/C1IN/ C1INH ORF/cDNA clone-Lentivirus plasmid (NM_001032295)

Pre-made Human SERPING1/C1IN/ C1INH Lentiviral expression plasmid for SERPING1 lentivirus packaging, SERPING1 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.

Target products collectionGo to SERPING1/C1IN products collection >>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)



Product information

Catalog No. Product Name Plasmid Grade Plasmid quantity
pGMLP001061 Human SERPING1 Lentivirus plasmid Research Grade 10mg, 50mg, 100mg, 500mg, >1g
GMP-like Grade 10mg, 50mg, 100mg, 500mg, >1g
High Quality (HQ) Grade
Seed 5ug


Product Description

Catalog ID pGMLP001061
Gene Name SERPING1
Accession Number NM_001032295
Gene ID 710
Species Human
Product Type Lentivirus plasmid (overexpression)
Insert Length 1503 bp
Gene Alias C1IN, C1INH, C1NH, HAE1, HAE2
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
Sequence ATGGCCTCCAGGCTGACCCTGCTGACCCTCCTGCTGCTGCTGCTGGCTGGGGATAGAGCCTCCTCAAATCCAAATGCTACCAGCTCCAGCTCCCAGGATCCAGAGAGTTTGCAAGACAGAGGCGAAGGGAAGGTCGCAACAACAGTTATCTCCAAGATGCTATTCGTTGAACCCATCCTGGAGGTTTCCAGCTTGCCGACAACCAACTCAACAACCAATTCAGCCACCAAAATAACAGCTAATACCACTGATGAACCCACCACACAACCCACCACAGAGCCCACCACCCAACCCACCATCCAACCCACCCAACCAACTACCCAGCTCCCAACAGATTCTCCTACCCAGCCCACTACTGGGTCCTTCTGCCCAGGACCTGTTACTCTCTGCTCTGACTTGGAGAGTCATTCAACAGAGGCCGTGTTGGGGGATGCTTTGGTAGATTTCTCCCTGAAGCTCTACCACGCCTTCTCAGCAATGAAGAAGGTGGAGACCAACATGGCCTTTTCCCCATTCAGCATCGCCAGCCTCCTTACCCAGGTCCTGCTCGGGGCTGGGGAGAACACCAAAACAAACCTGGAGAGCATCCTCTCTTACCCCAAGGACTTCACCTGTGTCCACCAGGCCCTGAAGGGCTTCACGACCAAAGGTGTCACCTCAGTCTCTCAGATCTTCCACAGCCCAGACCTGGCCATAAGGGACACCTTTGTGAATGCCTCTCGGACCCTGTACAGCAGCAGCCCCAGAGTCCTAAGCAACAACAGTGACGCCAACTTGGAGCTCATCAACACCTGGGTGGCCAAGAACACCAACAACAAGATCAGCCGGCTGCTAGACAGTCTGCCCTCCGATACCCGCCTTGTCCTCCTCAATGCTATCTACCTGAGTGCCAAGTGGAAGACAACATTTGATCCCAAGAAAACCAGAATGGAACCCTTTCACTTCAAAAACTCAGTTATAAAAGTGCCCATGATGAATAGCAAGAAGTACCCTGTGGCCCATTTCATTGACCAAACTTTGAAAGCCAAGGTGGGGCAGCTGCAGCTCTCCCACAATCTGAGTTTGGTGATCCTGGTACCCCAGAACCTGAAACATCGTCTTGAAGACATGGAACAGGCTCTCAGCCCTTCTGTTTTCAAGGCCATCATGGAGAAACTGGAGATGTCCAAGTTCCAGCCCACTCTCCTAACACTACCCCGCATCAAAGTGACGACCAGCCAGGATATGCTCTCAATCATGGAGAAATTGGAATTCTTCGATTTTTCTTATGACCTTAACCTGTGTGGGCTGACAGAGGACCCAGATCTTCAGGTTTCTGCGATGCAGCACCAGACAGTGCTGGAACTGACAGAGACTGGGGTGGAGGCGGCTGCAGCCTCCGCCATCTCTGTGGCCCGCACCCTGCTGGTCTTTGAAGTGCAGCAGCCCTTCCTCTTCGTGCTCTGGGACCAGCAGCACAAGTTCCCTGTCTTCATGGGGCGAGTATATGACCCCAGGGCCTGA

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-T24211-Ab Anti-IC1/ SERPING1/ C1IN functional antibody
    Target Antigen GM-Tg-g-T24211-Ag SERPING1 protein
    ORF Viral Vector pGMLP001061 Human SERPING1 Lentivirus plasmid
    ORF Viral Vector vGMLP001061 Human SERPING1 Lentivirus particle


    Target information

    Target ID GM-T24211
    Target Name SERPING1
    Gene ID 710, 12258, 703928, 295703, 101087683, 475966, 281035, 100066476
    Gene Symbol and Synonyms C1 Inh,C1-IA,C1IN,C1INH,C1INH.,C1NH,HAE1,HAE2,SERPING1
    Uniprot Accession P05155
    Uniprot Entry Name IC1_HUMAN
    Protein Sub-location Secreted Protein/Potential Cytokines
    Category Therapeutics Target
    Disease Not Available
    Gene Ensembl ENSG00000149131
    Target Classification Not Available

    This gene encodes a highly glycosylated plasma protein involved in the regulation of the complement cascade. Its encoded protein, C1 inhibitor, inhibits activated C1r and C1s of the first complement component and thus regulates complement activation. It is synthesized in the liver, and its deficiency is associated with hereditary angioneurotic oedema (HANE). Alternative splicing results in multiple transcript variants encoding the same isoform. [provided by RefSeq, May 2020]



    About GMVC

    GDU



    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.