Human GABRB1/EIEE45 ORF/cDNA clone-Lentivirus plasmid (NM_000812)

Cat. No.: pGMLP001197
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days

Pre-made Human GABRB1/EIEE45 Lentiviral expression plasmid for GABRB1 lentivirus packaging, GABRB1 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.


Target products collection

Go to GABRB1/EIEE45 products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Purchase
Total Price: $699
Shipping fee: Limited-time free
For payment issues, contact us.


Product Description

Catalog ID pGMLP001197
Gene Name GABRB1
Accession Number NM_000812
Gene ID 2560
Species Human
Product Type Lentivirus plasmid (overexpression)
Insert Length 1425 bp
Gene Alias EIEE45
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGTGGACAGTACAAAATCGAGAGAGTCTGGGGCTTCTCTCTTTCCCTGTGATGATTACCATGGTCTGTTGTGCACACAGCACCAATGAACCCAGCAACATGTCATACGTGAAAGAGACAGTGGACAGATTGCTCAAAGGATATGACATTCGCTTGCGGCCGGACTTCGGAGGGCCCCCCGTCGACGTTGGGATGCGGATCGATGTCGCCAGCATAGACATGGTCTCCGAAGTGAATATGGATTATACACTCACCATGTATTTCCAGCAGTCTTGGAAAGACAAAAGGCTTTCTTATTCTGGAATCCCACTGAACCTCACCCTAGACAATAGGGTAGCTGACCAACTCTGGGTACCAGACACCTACTTTCTGAATGACAAGAAATCATTTGTGCATGGGGTCACAGTGAAAAATCGAATGATTCGACTGCATCCTGATGGAACAGTTCTCTATGGACTCCGAATCACAACCACAGCTGCATGTATGATGGATCTTCGAAGATATCCATTGGATGAGCAGAACTGCACCCTGGAGATCGAAAGTTATGGCTATACCACTGATGACATTGAATTTTACTGGAATGGAGGAGAAGGGGCAGTCACTGGTGTTAATAAAATCGAACTTCCTCAATTTTCAATTGTTGACTACAAGATGGTGTCTAAGAAGGTGGAGTTCACAACAGGAGCGTATCCACGACTGTCACTAAGTTTTCGTCTAAAGAGAAACATTGGTTACTTCATTTTGCAAACCTACATGCCTTCTACACTGATTACAATTCTGTCCTGGGTGTCTTTTTGGATCAACTATGATGCATCTGCAGCCAGAGTCGCACTAGGAATCACGACAGTGCTTACAATGACAACCATCAGCACCCACCTCAGGGAGACCCTGCCAAAGATCCCTTATGTCAAAGCGATTGATATTTATCTGATGGGTTGCTTTGTGTTTGTGTTCCTGGCTCTGCTGGAGTATGCCTTTGTAAATTACATCTTCTTTGGGAAAGGCCCTCAGAAAAAGGGAGCTAGCAAACAAGACCAGAGTGCCAATGAGAAGAATAAACTGGAGATGAATAAAGTCCAGGTCGACGCCCACGGTAACATTCTCCTCAGCACCCTGGAAATCCGGAATGAGACGAGTGGCTCGGAAGTGCTCACGAGCGTGAGCGACCCCAAGGCCACCATGTACTCCTATGACAGCGCCAGCATCCAGTACCGCAAGCCCCTGAGCAGCCGCGAGGCCTACGGGCGCGCCCTGGACCGGCACGGGGTACCCAGCAAGGGGCGCATCCGCAGGCGTGCCTCCCAGCTCAAAGTCAAGATCCCCGACTTGACTGATGTGAATTCCATAGACAAGTGGTCCCGAATGTTTTTCCCCATCACCTTTTCTCTTTTTAATGTCGTCTATTGGCTTTACTATGTACACTGA
ORF Protein Sequence MWTVQNRESLGLLSFPVMITMVCCAHSTNEPSNMSYVKETVDRLLKGYDIRLRPDFGGPPVDVGMRIDVASIDMVSEVNMDYTLTMYFQQSWKDKRLSYSGIPLNLTLDNRVADQLWVPDTYFLNDKKSFVHGVTVKNRMIRLHPDGTVLYGLRITTTAACMMDLRRYPLDEQNCTLEIESYGYTTDDIEFYWNGGEGAVTGVNKIELPQFSIVDYKMVSKKVEFTTGAYPRLSLSFRLKRNIGYFILQTYMPSTLITILSWVSFWINYDASAARVALGITTVLTMTTISTHLRETLPKIPYVKAIDIYLMGCFVFVFLALLEYAFVNYIFFGKGPQKKGASKQDQSANEKNKLEMNKVQVDAHGNILLSTLEIRNETSGSEVLTSVSDPKATMYSYDSASIQYRKPLSSREAYGRALDRHGVPSKGRIRRRASQLKVKIPDLTDVNSIDKWSRMFFPITFSLFNVVYWLYYVH

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-MP0470-Ab Anti-GBRB1/ GABRB1/ EIEE45 monoclonal antibody
    Target Antigen GM-Tg-g-MP0470-Ag GABRB1 VLP (virus-like particle)
    ORF Viral Vector pGMLP001197 Human GABRB1 Lentivirus plasmid
    ORF Viral Vector vGMLP001197 Human GABRB1 Lentivirus particle


    Target information

    Target ID GM-MP0470
    Target Name GABRB1
    Gene ID 2560, 14400, 711217, 25450, 101097640, 100687745, 282239, 106782983
    Gene Symbol and Synonyms B230208N19Rik,DEE45,EIEE45,Gabrb-1,GABRB1,GARB1
    Uniprot Accession P18505
    Uniprot Entry Name GBRB1_HUMAN
    Protein Sub-location Transmembrane Protein
    Category Not Available
    Disease Not Available
    Gene Ensembl ENSG00000163288
    Target Classification Not Available

    The gamma-aminobutyric acid (GABA) A receptor is a multisubunit chloride channel that mediates the fastest inhibitory synaptic transmission in the central nervous system. This gene encodes GABA A receptor, beta 1 subunit. It is mapped to chromosome 4p12 in a cluster comprised of genes encoding alpha 4, alpha 2 and gamma 1 subunits of the GABA A receptor. Alteration of this gene is implicated in the pathogenetics of schizophrenia. [provided by RefSeq, Jul 2008]



    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.