Human KCNJ11/BIR/HHF2 ORF/cDNA clone-Lentivirus plasmid (NM_000525)

Cat. No.: pGMLP001204
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days

Pre-made Human KCNJ11/BIR/HHF2 Lentiviral expression plasmid for KCNJ11 lentivirus packaging, KCNJ11 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.

pdf Datasheet
pdf MSDS
pdf Terms of Use
Target products collection

Go to KCNJ11/BIR products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Purchase
Total Price: $628.44
Shipping fee: Limited-time free
For payment issues, contact us.


Product Description

Catalog ID pGMLP001204
Gene Name KCNJ11
Accession Number NM_000525
Gene ID 3767
Species Human
Product Type Lentivirus plasmid (overexpression)
Insert Length 1173 bp
Gene Alias BIR,HHF2,IKATP,KIR6.2,MODY13,PHHI,TNDM3
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGCTGTCCCGCAAGGGCATCATCCCCGAGGAATACGTGCTGACACGCCTGGCAGAGGACCCTGCCAAGCCCAGGTACCGTGCCCGCCAGCGGAGGGCCCGCTTTGTGTCCAAGAAAGGCAACTGCAACGTGGCCCACAAGAACATCCGGGAGCAGGGCCGCTTCCTGCAGGACGTGTTCACCACGCTGGTGGACCTCAAGTGGCCACACACATTGCTCATCTTCACCATGTCCTTCCTGTGCAGCTGGCTGCTCTTCGCCATGGCCTGGTGGCTCATCGCCTTCGCCCACGGTGACCTGGCCCCCAGCGAGGGCACTGCTGAGCCCTGTGTCACCAGCATCCACTCCTTCTCGTCTGCCTTCCTTTTCTCCATTGAGGTCCAAGTGACTATTGGCTTTGGGGGGCGCATGGTGACTGAGGAGTGCCCACTGGCCATCCTGATCCTCATCGTGCAGAACATCGTGGGGCTCATGATCAACGCCATCATGCTTGGCTGCATCTTCATGAAGACTGCCCAAGCCCACCGCAGGGCTGAGACCCTCATCTTCAGCAAGCATGCGGTGATCGCCCTGCGCCACGGCCGCCTCTGCTTCATGCTACGTGTGGGTGACCTCCGCAAGAGCATGATCATCAGCGCCACCATCCACATGCAGGTGGTACGCAAGACCACCAGCCCCGAGGGCGAGGTGGTGCCCCTCCACCAGGTGGACATCCCCATGGAGAACGGCGTGGGTGGCAACAGCATCTTCCTGGTGGCCCCGCTGATCATCTACCATGTCATTGATGCCAACAGCCCACTCTACGACCTGGCACCCAGCGACCTGCACCACCACCAGGACCTCGAGATCATCGTCATCCTGGAAGGCGTGGTGGAAACCACGGGCATCACCACCCAGGCCCGCACCTCCTACCTGGCCGATGAGATCCTGTGGGGCCAGCGCTTTGTGCCCATTGTAGCTGAGGAGGACGGACGTTACTCTGTGGACTACTCCAAGTTTGGCAACACCGTCAAAGTGCCCACACCACTCTGCACGGCCCGCCAGCTTGATGAGGACCACAGCCTACTGGAAGCTCTGACCCTCGCCTCAGCCCGCGGGCCCCTGCGCAAGCGCAGCGTGCCCATGGCCAAGGCCAAGCCCAAGTTCAGCATCTCTCCAGATTCCCTGTCCTGA
ORF Protein Sequence MLSRKGIIPEEYVLTRLAEDPAKPRYRARQRRARFVSKKGNCNVAHKNIREQGRFLQDVFTTLVDLKWPHTLLIFTMSFLCSWLLFAMAWWLIAFAHGDLAPSEGTAEPCVTSIHSFSSAFLFSIEVQVTIGFGGRMVTEECPLAILILIVQNIVGLMINAIMLGCIFMKTAQAHRRAETLIFSKHAVIALRHGRLCFMLRVGDLRKSMIISATIHMQVVRKTTSPEGEVVPLHQVDIPMENGVGGNSIFLVAPLIIYHVIDANSPLYDLAPSDLHHHQDLEIIVILEGVVETTGITTQARTSYLADEILWGQRFVPIVAEEDGRYSVDYSKFGNTVKVPTPLCTARQLDEDHSLLEALTLASARGPLRKRSVPMAKAKPKFSISPDSLS

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-T00820-Ab Anti-KCJ11/ KCNJ11/ BIR monoclonal antibody
    Target Antigen GM-Tg-g-T00820-Ag KCNJ11 VLP (virus-like particle)
    ORF Viral Vector pGMLP001204 Human KCNJ11 Lentivirus plasmid
    ORF Viral Vector vGMLP001204 Human KCNJ11 Lentivirus particle


    Target information

    Target ID GM-T00820
    Target Name KCNJ11
    Gene ID 3767, 16514, 696722, 83535, 101097019, 485401, 532060, 100056520
    Gene Symbol and Synonyms BIR,HHF2,IKATP,KCNJ11,KIR6.2,mBIR,MODY13,PHHI,PNDM2,TNDM3
    Uniprot Accession Q14654
    Uniprot Entry Name KCJ11_HUMAN
    Protein Sub-location Transmembrane Protein
    Category Therapeutics Target
    Disease Not Available
    Gene Ensembl ENSG00000187486
    Target Classification Ion Channel

    Potassium channels are present in most mammalian cells, where they participate in a wide range of physiologic responses. The protein encoded by this gene is an integral membrane protein and inward-rectifier type potassium channel. The encoded protein, which has a greater tendency to allow potassium to flow into a cell rather than out of a cell, is controlled by G-proteins and is found associated with the sulfonylurea receptor SUR. Mutations in this gene are a cause of familial persistent hyperinsulinemic hypoglycemia of infancy (PHHI), an autosomal recessive disorder characterized by unregulated insulin secretion. Defects in this gene may also contribute to autosomal dominant non-insulin-dependent diabetes mellitus type II (NIDDM), transient neonatal diabetes mellitus type 3 (TNDM3), and permanent neonatal diabetes mellitus (PNDM). Multiple alternatively spliced transcript variants that encode different protein isoforms have been described for this gene. [provided by RefSeq, Oct 2009]



    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.