Human TSPAN32/ART1/PHEMX ORF/cDNA clone-Lentivirus plasmid (NM_139022)

Cat. No.: pGMLP001216
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days

Pre-made Human TSPAN32/ART1/PHEMX Lentiviral expression plasmid for TSPAN32 lentivirus packaging, TSPAN32 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.

pdf Datasheet
pdf MSDS
pdf Terms of Use
Target products collection

Go to TSPAN32/ART1 products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Purchase
Total Price: $540.75
Shipping fee: Limited-time free
For payment issues, contact us.


Product Description

Catalog ID pGMLP001216
Gene Name TSPAN32
Accession Number NM_139022
Gene ID 10077
Species Human
Product Type Lentivirus plasmid (overexpression)
Insert Length 963 bp
Gene Alias ART1,PHEMX,PHMX,TSSC6
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGGGGCCTTGGAGTCGAGTCAGGGTTGCCAAATGCCAGATGCTGGTCACCTGCTTCTTTATCTTGCTGCTGGGCCTCTCTGTGGCCACCATGGTGACTCTTACCTACTTCGGGGCCCACTTTGCTGTCATCCGCCGAGCGTCCCTGGAGAAGAACCCGTACCAGGCTGTGCACCAATGGGCCTTCTCTGCGGGGTTGAGCCTGGTGGGCCTCCTGACTCTGGGAGCCGTGCTGAGCGCTGCAGCCACCGTGAGGGAGGCCCAGGGCCTCATGGCAGGGGGCTTCCTGTGCTTCTCCCTGGCGTTCTGCGCACAGGTGCAGGTGGTGTTCTGGAGACTCCACAGCCCCACCCAGGTGGAGGACGCCATGCTGGACACCTACGACCTGGTATATGAGCAGGCGATGAAAGGTACGTCCCACGTCCGGCGGCAGGAGCTGGCGGCCATCCAGGACGTGTTTCTGTGCTGTGGGAAGAAGTCTCCTTTCAGCCGTCTGGGGAGCACAGAGGCTGACCTGTGTCAGGGAGAGGAGGCGGCGAGAGAGGACTGCCTTCAGGGCATCCGGAGCTTCCTGAGGACACACCAGCAGGTCGCCTCCAGCCTGACCAGCATCGGCCTGGCCCTCACGGTGTCCGCCTTGCTCTTCAGCTCCTTCCTGTGGTTTGCCATCCGCTGTGGCTGCAGCTTGGACCGCAAGGGCAAATACACCCTGACCCCACGAGCATGTGGCCGCCAGCCCCAGGAGCCCAGCCTCTTGAGATGCTCCCAGGGTGGACCCACACATTGTCTCCACTCCGAAGCAGTTGCTATTGGTCCAAGAGGATGCTCGGGTAGTCTTCGGTGGCTGCAGGAGAGCGATGCTGCGCCTCTGCCCCTCTCCTGCCACCTGGCTGCCCACAGAGCTCTCCAGGGCAGAAGTCGCGGTGGGCTCAGTGGGTGCCCTGAGCGGGGTCTCTCAGACTGA
ORF Protein Sequence MGPWSRVRVAKCQMLVTCFFILLLGLSVATMVTLTYFGAHFAVIRRASLEKNPYQAVHQWAFSAGLSLVGLLTLGAVLSAAATVREAQGLMAGGFLCFSLAFCAQVQVVFWRLHSPTQVEDAMLDTYDLVYEQAMKGTSHVRRQELAAIQDVFLCCGKKSPFSRLGSTEADLCQGEEAAREDCLQGIRSFLRTHQQVASSLTSIGLALTVSALLFSSFLWFAIRCGCSLDRKGKYTLTPRACGRQPQEPSLLRCSQGGPTHCLHSEAVAIGPRGCSGSLRWLQESDAAPLPLSCHLAAHRALQGRSRGGLSGCPERGLSD

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-IP2193-Ab Anti-TSPAN32 monoclonal antibody
    Target Antigen GM-Tg-g-IP2193-Ag TSPAN32 protein
    ORF Viral Vector pGMLP001216 Human TSPAN32 Lentivirus plasmid
    ORF Viral Vector vGMLP001216 Human TSPAN32 Lentivirus particle


    Target information

    Target ID GM-IP2193
    Target Name TSPAN32
    Gene ID 10077, 27027, 704862, 365390, 101093396, 483667, 530507, 100630547
    Gene Symbol and Synonyms Art-1,ART1,D7Wsu37e,PHEMX,PHMX,TSPAN32,TSSC6
    Uniprot Accession Q96QS1
    Uniprot Entry Name TSN32_HUMAN
    Protein Sub-location Introcelluar Protein
    Category Not Available
    Disease Not Available
    Gene Ensembl ENSG00000064201
    Target Classification Not Available

    This gene, which is a member of the tetraspanin superfamily, is one of several tumor-suppressing subtransferable fragments located in the imprinted gene domain of chromosome 11p15.5, an important tumor-suppressor gene region. Alterations in this region have been associated with Beckwith-Wiedemann syndrome, Wilms tumor, rhabdomyosarcoma, adrenocortical carcinoma, and lung, ovarian and breast cancers. This gene is located among several imprinted genes; however, this gene, as well as the tumor-suppressing subchromosomal transferable fragment 4, escapes imprinting. This gene may play a role in malignancies and diseases that involve this region, and it is also involved in hematopoietic cell function. Alternatively spliced transcript variants have been described, but their biological validity has not been determined. [provided by RefSeq, Jul 2008]



    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.