Human TSPAN32/ART1/PHEMX ORF/cDNA clone-Lentivirus plasmid (NM_139022)
Cat. No.: pGMLP001216
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days
Pre-made Human TSPAN32/ART1/PHEMX Lentiviral expression plasmid for TSPAN32 lentivirus packaging, TSPAN32 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.
Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.
Go to
TSPAN32/ART1 products
collection>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product Description
Catalog ID | pGMLP001216 |
Gene Name | TSPAN32 |
Accession Number | NM_139022 |
Gene ID | 10077 |
Species | Human |
Product Type | Lentivirus plasmid (overexpression) |
Insert Length | 963 bp |
Gene Alias | ART1,PHEMX,PHMX,TSSC6 |
Fluorescent Reporter | ZsGreen |
Mammalian Cell Selection | Puromyocin |
Fusion Tag | 3xflag (C-Terminal) |
Promoter | CMV |
Resistance | Amplicin |
ORF Nucleotide Sequence | ATGGGGCCTTGGAGTCGAGTCAGGGTTGCCAAATGCCAGATGCTGGTCACCTGCTTCTTTATCTTGCTGCTGGGCCTCTCTGTGGCCACCATGGTGACTCTTACCTACTTCGGGGCCCACTTTGCTGTCATCCGCCGAGCGTCCCTGGAGAAGAACCCGTACCAGGCTGTGCACCAATGGGCCTTCTCTGCGGGGTTGAGCCTGGTGGGCCTCCTGACTCTGGGAGCCGTGCTGAGCGCTGCAGCCACCGTGAGGGAGGCCCAGGGCCTCATGGCAGGGGGCTTCCTGTGCTTCTCCCTGGCGTTCTGCGCACAGGTGCAGGTGGTGTTCTGGAGACTCCACAGCCCCACCCAGGTGGAGGACGCCATGCTGGACACCTACGACCTGGTATATGAGCAGGCGATGAAAGGTACGTCCCACGTCCGGCGGCAGGAGCTGGCGGCCATCCAGGACGTGTTTCTGTGCTGTGGGAAGAAGTCTCCTTTCAGCCGTCTGGGGAGCACAGAGGCTGACCTGTGTCAGGGAGAGGAGGCGGCGAGAGAGGACTGCCTTCAGGGCATCCGGAGCTTCCTGAGGACACACCAGCAGGTCGCCTCCAGCCTGACCAGCATCGGCCTGGCCCTCACGGTGTCCGCCTTGCTCTTCAGCTCCTTCCTGTGGTTTGCCATCCGCTGTGGCTGCAGCTTGGACCGCAAGGGCAAATACACCCTGACCCCACGAGCATGTGGCCGCCAGCCCCAGGAGCCCAGCCTCTTGAGATGCTCCCAGGGTGGACCCACACATTGTCTCCACTCCGAAGCAGTTGCTATTGGTCCAAGAGGATGCTCGGGTAGTCTTCGGTGGCTGCAGGAGAGCGATGCTGCGCCTCTGCCCCTCTCCTGCCACCTGGCTGCCCACAGAGCTCTCCAGGGCAGAAGTCGCGGTGGGCTCAGTGGGTGCCCTGAGCGGGGTCTCTCAGACTGA |
ORF Protein Sequence | MGPWSRVRVAKCQMLVTCFFILLLGLSVATMVTLTYFGAHFAVIRRASLEKNPYQAVHQWAFSAGLSLVGLLTLGAVLSAAATVREAQGLMAGGFLCFSLAFCAQVQVVFWRLHSPTQVEDAMLDTYDLVYEQAMKGTSHVRRQELAAIQDVFLCCGKKSPFSRLGSTEADLCQGEEAAREDCLQGIRSFLRTHQQVASSLTSIGLALTVSALLFSSFLWFAIRCGCSLDRKGKYTLTPRACGRQPQEPSLLRCSQGGPTHCLHSEAVAIGPRGCSGSLRWLQESDAAPLPLSCHLAAHRALQGRSRGGLSGCPERGLSD |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
Category | Cat No. | Products Name |
---|---|---|
Target Antibody | GM-Tg-g-IP2193-Ab | Anti-TSPAN32 monoclonal antibody |
Target Antigen | GM-Tg-g-IP2193-Ag | TSPAN32 protein |
ORF Viral Vector | pGMLP001216 | Human TSPAN32 Lentivirus plasmid |
ORF Viral Vector | vGMLP001216 | Human TSPAN32 Lentivirus particle |
Target information
Target ID | GM-IP2193 |
Target Name | TSPAN32 |
Gene ID | 10077, 27027, 704862, 365390, 101093396, 483667, 530507, 100630547 |
Gene Symbol and Synonyms | Art-1,ART1,D7Wsu37e,PHEMX,PHMX,TSPAN32,TSSC6 |
Uniprot Accession | Q96QS1 |
Uniprot Entry Name | TSN32_HUMAN |
Protein Sub-location | Introcelluar Protein |
Category | Not Available |
Disease | Not Available |
Gene Ensembl | ENSG00000064201 |
Target Classification | Not Available |
This gene, which is a member of the tetraspanin superfamily, is one of several tumor-suppressing subtransferable fragments located in the imprinted gene domain of chromosome 11p15.5, an important tumor-suppressor gene region. Alterations in this region have been associated with Beckwith-Wiedemann syndrome, Wilms tumor, rhabdomyosarcoma, adrenocortical carcinoma, and lung, ovarian and breast cancers. This gene is located among several imprinted genes; however, this gene, as well as the tumor-suppressing subchromosomal transferable fragment 4, escapes imprinting. This gene may play a role in malignancies and diseases that involve this region, and it is also involved in hematopoietic cell function. Alternatively spliced transcript variants have been described, but their biological validity has not been determined. [provided by RefSeq, Jul 2008]
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.