Human E2F5/E2F-5 ORF/cDNA clone-Lentivirus plasmid (NM_001951)

Cat. No.: pGMLP001233
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days

Pre-made Human E2F5/E2F-5 Lentiviral expression plasmid for E2F5 lentivirus packaging, E2F5 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.

pdf Datasheet
pdf MSDS
pdf Terms of Use
Target products collection

Go to E2F5/E2F-5 products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Purchase
Total Price: $591.48
Shipping fee: Limited-time free
For payment issues, contact us.


Product Description

Catalog ID pGMLP001233
Gene Name E2F5
Accession Number NM_001951
Gene ID 1875
Species Human
Product Type Lentivirus plasmid (overexpression)
Insert Length 1041 bp
Gene Alias E2F-5
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGGCGGCGGCAGAGCCCGCGAGCTCGGGCCAGCAGGCGCCGGCAGGGCAGGGGCAGGGCCAGCGGCCGCCGCCGCAGCCTCCGCAGGCGCAAGCCCCGCAGCCGCCCCCGCCGCCGCAGCTCGGGGGCGCCGGGGGCGGCAGCAGCAGGCACGAGAAGAGCCTGGGGCTGCTCACTACCAAGTTCGTGTCGCTGCTGCAGGAGGCCAAGGACGGCGTTCTGGATCTCAAAGCGGCTGCTGATACTTTGGCTGTGAGGCAAAAAAGGAGAATTTATGATATCACCAATGTCTTAGAGGGAATTGACTTGATTGAAAAAAAGTCAAAAAACAGTATCCAGTGGAAAGGTGTAGGTGCTGGCTGTAATACTAAAGAAGTCATAGATAGATTAAGATATCTTAAAGCTGAAATTGAAGATCTAGAACTGAAGGAAAGAGAACTTGATCAGCAGAAGTTGTGGCTACAGCAAAGCATCAAAAATGTGATGGACGATTCCATTAATAATAGATTTTCCTATGTAACTCATGAAGACATCTGTAATTGCTTTAATGGTGATACACTTTTGGCCATTCAGGCACCTTCTGGTACACAACTGGAGGTACCCATTCCAGAAATGGGTCAGAATGGACAAAAGAAATACCAGATCAATCTAAAGAGTCATTCAGGACCTATCCATGTGCTGCTTATAAATAAAGAGTCGAGTTCATCTAAGCCCGTGGTTTTTCCTGTTCCCCCACCTGATGACCTCACACAGCCTTCCTCCCAGTCCTTGACTCCAGTGACTCCACAGAAATCCAGCATGGCAACTCAAAATCTGCCTGAGCAACATGTCTCTGAAAGAAGCCAGGCTCTGCAGCAGACATCAGCTACAGATATATCTTCAGCAGGATCTATTAGTGGAGATATCATTGATGAGTTAATGTCTTCTGACGTGTTTCCTCTCTTAAGGCTTTCTCCTACCCCGGCAGATGACTACAACTTTAATTTAGATGATAACGAAGGAGTTTGTGATCTGTTTGATGTCCAGATACTAAATTATTAG
ORF Protein Sequence MAAAEPASSGQQAPAGQGQGQRPPPQPPQAQAPQPPPPPQLGGAGGGSSRHEKSLGLLTTKFVSLLQEAKDGVLDLKAAADTLAVRQKRRIYDITNVLEGIDLIEKKSKNSIQWKGVGAGCNTKEVIDRLRYLKAEIEDLELKERELDQQKLWLQQSIKNVMDDSINNRFSYVTHEDICNCFNGDTLLAIQAPSGTQLEVPIPEMGQNGQKKYQINLKSHSGPIHVLLINKESSSSKPVVFPVPPPDDLTQPSSQSLTPVTPQKSSMATQNLPEQHVSERSQALQQTSATDISSAGSISGDIIDELMSSDVFPLLRLSPTPADDYNFNLDDNEGVCDLFDVQILNY

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-IP0734-Ab Anti-E2F5 monoclonal antibody
    Target Antigen GM-Tg-g-IP0734-Ag E2F5 protein
    ORF Viral Vector pGMLP001233 Human E2F5 Lentivirus plasmid
    ORF Viral Vector vGMLP001233 Human E2F5 Lentivirus particle


    Target information

    Target ID GM-IP0734
    Target Name E2F5
    Gene ID 1875, 13559, 703352, 116651, 101096875, 611103, 539427, 100056139
    Gene Symbol and Synonyms E2F-5,E2F5
    Uniprot Accession Q15329
    Uniprot Entry Name E2F5_HUMAN
    Protein Sub-location Introcelluar Protein
    Category Not Available
    Disease Not Available
    Gene Ensembl ENSG00000133740
    Target Classification Not Available

    The protein encoded by this gene is a member of the E2F family of transcription factors. The E2F family plays a crucial role in the control of cell cycle and action of tumor suppressor proteins and is also a target of the transforming proteins of small DNA tumor viruses. The E2F proteins contain several evolutionarily conserved domains that are present in most members of the family. These domains include a DNA binding domain, a dimerization domain which determines interaction with the differentiation regulated transcription factor proteins (DP), a transactivation domain enriched in acidic amino acids, and a tumor suppressor protein association domain which is embedded within the transactivation domain. This protein is differentially phosphorylated and is expressed in a wide variety of human tissues. It has higher identity to E2F4 than to other family members. Both this protein and E2F4 interact with tumor suppressor proteins p130 and p107, but not with pRB. Alternative splicing results in multiple variants encoding different isoforms. [provided by RefSeq, Jul 2008]



    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.