Human E2F5/E2F-5 ORF/cDNA clone-Lentivirus particle (NM_001951)
Cat. No.: vGMLP001233
Pre-made Human E2F5/E2F-5 Lentiviral expression plasmid for E2F5 lentivirus packaging, E2F5 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.
The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.
Go to
E2F5/E2F-5 products
collection>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Catalog No. | Product Name | lentivirus Grade | lentivirus quantity |
---|---|---|---|
vGMLP001233 | Human E2F5 Lentivirus particle | Pilot Grade | 1.0E+8TU |
5.0E+8TU | |||
1.0E+9TU | |||
Research Grade | 1.0E+8TU | ||
5.0E+8TU | |||
1.0E+9TU | |||
GMP-like Grade | inquiry | ||
GMP Grade | inquiry |
Product Description
Catalog ID | vGMLP001233 |
Gene Name | E2F5 |
Accession Number | NM_001951 |
Gene ID | 1875 |
Species | Human |
Product Type | Lentivirus particle (overexpression) |
Insert Length | 1041 bp |
Gene Alias | E2F-5 |
Fluorescent Reporter | ZsGreen |
Mammalian Cell Selection | Puromyocin |
Fusion Tag | 3xflag (C-Terminal) |
Promoter | CMV |
Resistance | Amplicin |
ORF Nucleotide Sequence | ATGGCGGCGGCAGAGCCCGCGAGCTCGGGCCAGCAGGCGCCGGCAGGGCAGGGGCAGGGCCAGCGGCCGCCGCCGCAGCCTCCGCAGGCGCAAGCCCCGCAGCCGCCCCCGCCGCCGCAGCTCGGGGGCGCCGGGGGCGGCAGCAGCAGGCACGAGAAGAGCCTGGGGCTGCTCACTACCAAGTTCGTGTCGCTGCTGCAGGAGGCCAAGGACGGCGTTCTGGATCTCAAAGCGGCTGCTGATACTTTGGCTGTGAGGCAAAAAAGGAGAATTTATGATATCACCAATGTCTTAGAGGGAATTGACTTGATTGAAAAAAAGTCAAAAAACAGTATCCAGTGGAAAGGTGTAGGTGCTGGCTGTAATACTAAAGAAGTCATAGATAGATTAAGATATCTTAAAGCTGAAATTGAAGATCTAGAACTGAAGGAAAGAGAACTTGATCAGCAGAAGTTGTGGCTACAGCAAAGCATCAAAAATGTGATGGACGATTCCATTAATAATAGATTTTCCTATGTAACTCATGAAGACATCTGTAATTGCTTTAATGGTGATACACTTTTGGCCATTCAGGCACCTTCTGGTACACAACTGGAGGTACCCATTCCAGAAATGGGTCAGAATGGACAAAAGAAATACCAGATCAATCTAAAGAGTCATTCAGGACCTATCCATGTGCTGCTTATAAATAAAGAGTCGAGTTCATCTAAGCCCGTGGTTTTTCCTGTTCCCCCACCTGATGACCTCACACAGCCTTCCTCCCAGTCCTTGACTCCAGTGACTCCACAGAAATCCAGCATGGCAACTCAAAATCTGCCTGAGCAACATGTCTCTGAAAGAAGCCAGGCTCTGCAGCAGACATCAGCTACAGATATATCTTCAGCAGGATCTATTAGTGGAGATATCATTGATGAGTTAATGTCTTCTGACGTGTTTCCTCTCTTAAGGCTTTCTCCTACCCCGGCAGATGACTACAACTTTAATTTAGATGATAACGAAGGAGTTTGTGATCTGTTTGATGTCCAGATACTAAATTATTAG |
ORF Protein Sequence | MAAAEPASSGQQAPAGQGQGQRPPPQPPQAQAPQPPPPPQLGGAGGGSSRHEKSLGLLTTKFVSLLQEAKDGVLDLKAAADTLAVRQKRRIYDITNVLEGIDLIEKKSKNSIQWKGVGAGCNTKEVIDRLRYLKAEIEDLELKERELDQQKLWLQQSIKNVMDDSINNRFSYVTHEDICNCFNGDTLLAIQAPSGTQLEVPIPEMGQNGQKKYQINLKSHSGPIHVLLINKESSSSKPVVFPVPPPDDLTQPSSQSLTPVTPQKSSMATQNLPEQHVSERSQALQQTSATDISSAGSISGDIIDELMSSDVFPLLRLSPTPADDYNFNLDDNEGVCDLFDVQILNY |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
Category | Cat No. | Products Name |
---|---|---|
Target Antibody | GM-Tg-g-IP0734-Ab | Anti-E2F5 monoclonal antibody |
Target Antigen | GM-Tg-g-IP0734-Ag | E2F5 protein |
ORF Viral Vector | pGMLP001233 | Human E2F5 Lentivirus plasmid |
ORF Viral Vector | vGMLP001233 | Human E2F5 Lentivirus particle |
Target information
Target ID | GM-IP0734 |
Target Name | E2F5 |
Gene ID | 1875, 13559, 703352, 116651, 101096875, 611103, 539427, 100056139 |
Gene Symbol and Synonyms | E2F-5,E2F5 |
Uniprot Accession | Q15329 |
Uniprot Entry Name | E2F5_HUMAN |
Protein Sub-location | Introcelluar Protein |
Category | Not Available |
Disease | Not Available |
Gene Ensembl | ENSG00000133740 |
Target Classification | Not Available |
The protein encoded by this gene is a member of the E2F family of transcription factors. The E2F family plays a crucial role in the control of cell cycle and action of tumor suppressor proteins and is also a target of the transforming proteins of small DNA tumor viruses. The E2F proteins contain several evolutionarily conserved domains that are present in most members of the family. These domains include a DNA binding domain, a dimerization domain which determines interaction with the differentiation regulated transcription factor proteins (DP), a transactivation domain enriched in acidic amino acids, and a tumor suppressor protein association domain which is embedded within the transactivation domain. This protein is differentially phosphorylated and is expressed in a wide variety of human tissues. It has higher identity to E2F4 than to other family members. Both this protein and E2F4 interact with tumor suppressor proteins p130 and p107, but not with pRB. Alternative splicing results in multiple variants encoding different isoforms. [provided by RefSeq, Jul 2008]
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.