Human ERLIN2/C8orf2/ Erlin-2 ORF/cDNA clone-Lentivirus plasmid (NM_007175)

Pre-made Human ERLIN2/C8orf2/ Erlin-2 Lentiviral expression plasmid for ERLIN2 lentivirus packaging, ERLIN2 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.

Target products collectionGo to ERLIN2/C8orf2 products collection >>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)



Product information

Catalog No. Product Name Plasmid Grade Plasmid quantity
pGMLP001235 Human ERLIN2 Lentivirus plasmid Research Grade 10mg, 50mg, 100mg, 500mg, >1g
GMP-like Grade 10mg, 50mg, 100mg, 500mg, >1g
High Quality (HQ) Grade
Seed 5ug


Product Description

Catalog ID pGMLP001235
Gene Name ERLIN2
Accession Number NM_007175
Gene ID 11160
Species Human
Product Type Lentivirus plasmid (overexpression)
Insert Length 1020 bp
Gene Alias C8orf2, Erlin-2, NET32, SPFH2, SPG18
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
Sequence ATGGCTCAGTTGGGAGCAGTTGTGGCTGTGGCTTCCAGTTTCTTTTGTGCATCTCTCTTCTCAGCTGTGCACAAGATAGAAGAGGGACATATTGGGGTATATTACAGAGGCGGTGCCCTGCTGACTTCGACCAGCGGCCCTGGTTTCCATCTCATGCTCCCTTTCATCACATCATATAAGTCTGTGCAGACCACACTCCAGACAGATGAGGTGAAGAATGTACCTTGTGGGACTAGTGGTGGTGTGATGATCTACTTTGACAGAATTGAAGTGGTGAACTTCCTGGTCCCGAACGCAGTGTATGATATAGTGAAGAACTATACTGCTGACTATGACAAGGCCCTCATCTTCAACAAGATCCACCACGAACTGAACCAGTTCTGCAGTGTGCACACGCTTCAAGAGGTCTACATTGAGCTGTTTGATCAGATTGATGAAAATCTCAAACTGGCTTTGCAACAGGACCTGACCTCCATGGCCCCTGGGCTGGTCATTCAAGCTGTGCGGGTAACAAAGCCCAACATACCAGAGGCAATCCGCAGAAACTACGAGTTGATGGAAAGTGAGAAGACAAAGCTTCTCATTGCCGCCCAGAAACAGAAGGTGGTGGAAAAGGAAGCAGAGACAGAGCGGAAGAAGGCGCTCATTGAGGCAGAAAAAGTGGCCCAGGTGGCTGAGATCACCTACGGGCAGAAGGTGATGGAGAAGGAGACTGAGAAGAAGATTTCAGAAATTGAAGATGCTGCATTTCTGGCCCGGGAGAAGGCAAAGGCAGATGCTGAGTGCTACACTGCTATGAAAATAGCCGAAGCCAATAAGCTGAAGCTAACCCCTGAATATCTGCAGCTGATGAAGTACAAGGCCATTGCTTCCAACAGCAAGATTTACTTTGGCAAAGACATTCCTAACATGTTCATGGACTCTGCGGGCAGTGTGAGCAAGCAGTTTGAGGGGCTAGCTGACAAGCTAAGCTTTGGCTTAGAAGATGAACCCTTGGAGACGGCCACTAAGGAGAATTGA

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-MP2591-Ab Anti-ERLN2/ ERLIN2/ C8orf2 monoclonal antibody
    Target Antigen GM-Tg-g-MP2591-Ag ERLIN2 VLP (virus-like particle)
    ORF Viral Vector pGMLP001235 Human ERLIN2 Lentivirus plasmid
    ORF Viral Vector vGMLP001235 Human ERLIN2 Lentivirus particle


    Target information

    Target ID GM-MP2591
    Target Name ERLIN2
    Gene ID 11160, 244373, 698126, 290823, 101089349, 607518, 616278, 100057973
    Gene Symbol and Synonyms C8orf2,Erlin-2,ERLIN2,NET32,RGD1309010,SPFH2,SPG18
    Uniprot Accession O94905
    Uniprot Entry Name ERLN2_HUMAN
    Protein Sub-location Transmembrane Protein
    Category Not Available
    Disease Not Available
    Gene Ensembl ENSG00000147475
    Target Classification Not Available

    This gene encodes a member of the SPFH domain-containing family of lipid raft-associated proteins. The encoded protein is localized to lipid rafts of the endoplasmic reticulum and plays a critical role in inositol 1,4,5-trisphosphate (IP3) signaling by mediating ER-associated degradation of activated IP3 receptors. Mutations in this gene are a cause of spastic paraplegia-18 (SPG18). Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Feb 2012]



    About GMVC

    GDU



    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.