Human WRB/CHD5/GET1 ORF/cDNA clone-Lentivirus plasmid (NM_004627)

Cat. No.: pGMLP001284
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days

Pre-made Human WRB/CHD5/GET1 Lentiviral expression plasmid for WRB lentivirus packaging, WRB lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.


Target products collection

Go to WRB/CHD5 products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Purchase
Total Price: $431.25
Shipping fee: Limited-time free
For payment issues, contact us.


Product Description

Catalog ID pGMLP001284
Gene Name WRB
Accession Number NM_004627
Gene ID 7485
Species Human
Product Type Lentivirus plasmid (overexpression)
Insert Length 525 bp
Gene Alias CHD5,GET1
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGAGCTCAGCCGCGGCCGACCACTGGGCGTGGTTGCTGGTGCTCAGCTTCGTGTTTGGATGCAATGTTCTTAGGATCCTCCTCCCGTCCTTCTCATCCTTCATGTCCAGGGTGCTGCAGAAGGACGCGGAGCAGGAGTCACAGATGAGAGCGGAGATCCAGGACATGAAGCAGGAGCTCTCCACAGTCAACATGATGGACGAGTTTGCCAGATATGCCAGGCTGGAAAGAAAGATCAACAAGATGACGGATAAGCTCAAAACCCATGTGAAAGCTCGGACAGCTCAATTAGCCAAGATAAAATGGGTGATAAGTGTCGCTTTCTACGTATTGCAGGCTGCCCTGATGATCTCACTCATTTGGAAGTATTATTCTGTCCCTGTGGCTGTCGTGCCGAGTAAATGGATAACCCCTCTAGACCGCCTGGTAGCCTTTCCTACTAGAGTAGCAGGTGGTGTTGGAATTACCTGTTGGATTTTAGTCTGTAACAAAGTTGTCGCTATTGTGCTTCATCCGTTCAGCTGA
ORF Protein Sequence MSSAAADHWAWLLVLSFVFGCNVLRILLPSFSSFMSRVLQKDAEQESQMRAEIQDMKQELSTVNMMDEFARYARLERKINKMTDKLKTHVKARTAQLAKIKWVISVAFYVLQAALMISLIWKYYSVPVAVVPSKWITPLDRLVAFPTRVAGGVGITCWILVCNKVVAIVLHPFS

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-IP2281-Ab Anti-WRB monoclonal antibody
    Target Antigen GM-Tg-g-IP2281-Ag WRB protein
    ORF Viral Vector pGMLP001284 Human WRB Lentivirus plasmid
    ORF Viral Vector vGMLP001284 Human WRB Lentivirus particle


    Target information

    Target ID GM-IP2281
    Target Name WRB
    Gene ID 7485, 71446, 106997239, 288233, 101098734, 111093447, 100059393
    Gene Symbol and Synonyms 5530402J05Rik,C030018G21Rik,CHD5,GET1,WRB
    Uniprot Accession O00258
    Uniprot Entry Name GET1_HUMAN
    Protein Sub-location Introcelluar Protein
    Category Not Available
    Disease Not Available
    Gene Ensembl ENSG00000182093
    Target Classification Not Available

    This gene is located in the candidate region for congenital heart disease (CHD) in Down syndrome (DS). It encodes a basic protein that functions as a receptor that promotes insertion of tail-anchored proteins in the endoplasmic reticulum membrane. This gene is located at a maternally-methylated differentially methylated region (DMR); however, its transcription may be biallelic, not imprinted. Alternative splicing results in different transcript variants. A pseudogene has been defined on chromosome 4. [provided by RefSeq, Apr 2017]



    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.