Human WRB/CHD5/GET1 ORF/cDNA clone-Lentivirus particle (NM_004627)
Cat. No.: vGMLP001284
Pre-made Human WRB/CHD5/GET1 Lentiviral expression plasmid for WRB lentivirus packaging, WRB lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.
The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.
Go to
WRB/CHD5 products
collection>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
| Catalog No. | Product Name | lentivirus Grade | lentivirus quantity |
|---|---|---|---|
| vGMLP001284 | Human WRB Lentivirus particle | Pilot Grade | 1.0E+8TU |
| 5.0E+8TU | |||
| 1.0E+9TU | |||
| Research Grade | 1.0E+8TU | ||
| 5.0E+8TU | |||
| 1.0E+9TU | |||
| GMP-like Grade | inquiry | ||
| GMP Grade | inquiry |
Product Description
| Catalog ID | vGMLP001284 |
| Gene Name | WRB |
| Accession Number | NM_004627 |
| Gene ID | 7485 |
| Species | Human |
| Product Type | Lentivirus particle (overexpression) |
| Insert Length | 525 bp |
| Gene Alias | CHD5,GET1 |
| Fluorescent Reporter | ZsGreen |
| Mammalian Cell Selection | Puromyocin |
| Fusion Tag | 3xflag (C-Terminal) |
| Promoter | CMV |
| Resistance | Amplicin |
| ORF Nucleotide Sequence | ATGAGCTCAGCCGCGGCCGACCACTGGGCGTGGTTGCTGGTGCTCAGCTTCGTGTTTGGATGCAATGTTCTTAGGATCCTCCTCCCGTCCTTCTCATCCTTCATGTCCAGGGTGCTGCAGAAGGACGCGGAGCAGGAGTCACAGATGAGAGCGGAGATCCAGGACATGAAGCAGGAGCTCTCCACAGTCAACATGATGGACGAGTTTGCCAGATATGCCAGGCTGGAAAGAAAGATCAACAAGATGACGGATAAGCTCAAAACCCATGTGAAAGCTCGGACAGCTCAATTAGCCAAGATAAAATGGGTGATAAGTGTCGCTTTCTACGTATTGCAGGCTGCCCTGATGATCTCACTCATTTGGAAGTATTATTCTGTCCCTGTGGCTGTCGTGCCGAGTAAATGGATAACCCCTCTAGACCGCCTGGTAGCCTTTCCTACTAGAGTAGCAGGTGGTGTTGGAATTACCTGTTGGATTTTAGTCTGTAACAAAGTTGTCGCTATTGTGCTTCATCCGTTCAGCTGA |
| ORF Protein Sequence | MSSAAADHWAWLLVLSFVFGCNVLRILLPSFSSFMSRVLQKDAEQESQMRAEIQDMKQELSTVNMMDEFARYARLERKINKMTDKLKTHVKARTAQLAKIKWVISVAFYVLQAALMISLIWKYYSVPVAVVPSKWITPLDRLVAFPTRVAGGVGITCWILVCNKVVAIVLHPFS |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
| Category | Cat No. | Products Name |
|---|---|---|
| Target Antibody | GM-Tg-g-IP2281-Ab | Anti-WRB monoclonal antibody |
| Target Antigen | GM-Tg-g-IP2281-Ag | WRB protein |
| ORF Viral Vector | pGMLP001284 | Human WRB Lentivirus plasmid |
| ORF Viral Vector | vGMLP001284 | Human WRB Lentivirus particle |
Target information
| Target ID | GM-IP2281 |
| Target Name | WRB |
| Gene ID | 7485, 71446, 106997239, 288233, 101098734, 111093447, 100059393 |
| Gene Symbol and Synonyms | 5530402J05Rik,C030018G21Rik,CHD5,GET1,WRB |
| Uniprot Accession | O00258 |
| Uniprot Entry Name | GET1_HUMAN |
| Protein Sub-location | Introcelluar Protein |
| Category | Not Available |
| Disease | Not Available |
| Gene Ensembl | ENSG00000182093 |
| Target Classification | Not Available |
This gene is located in the candidate region for congenital heart disease (CHD) in Down syndrome (DS). It encodes a basic protein that functions as a receptor that promotes insertion of tail-anchored proteins in the endoplasmic reticulum membrane. This gene is located at a maternally-methylated differentially methylated region (DMR); however, its transcription may be biallelic, not imprinted. Alternative splicing results in different transcript variants. A pseudogene has been defined on chromosome 4. [provided by RefSeq, Apr 2017]
About GMVC

GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.


