Human CASQ1/CASQ/ PDIB1 ORF/cDNA clone-Lentivirus plasmid (NM_001231)

Pre-made Human CASQ1/CASQ/ PDIB1 Lentiviral expression plasmid for CASQ1 lentivirus packaging, CASQ1 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.

Target products collectionGo to CASQ1/CASQ products collection >>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)



Product information

Catalog No. Product Name Plasmid Grade Plasmid quantity
pGMLP001375 Human CASQ1 Lentivirus plasmid Research Grade 10mg, 50mg, 100mg, 500mg, >1g
GMP-like Grade 10mg, 50mg, 100mg, 500mg, >1g
High Quality (HQ) Grade
Seed 5ug


Product Description

Catalog ID pGMLP001375
Gene Name CASQ1
Accession Number NM_001231
Gene ID 844
Species Human
Product Type Lentivirus plasmid (overexpression)
Insert Length 1191 bp
Gene Alias CASQ, PDIB1, VMCQA
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
Sequence ATGAGTGCTACAGACAGGATGGGGCCCAGAGCTGTGCCGGGTCTGCGGCTGGCACTGCTGTTGCTGCTGGTGCTAGGGACACCCAAGTCAGGGGTACAGGGGCAGGAAGGGCTGGACTTCCCTGAGTACGATGGTGTGGACCGTGTGATCAATGTCAATGCAAAGAACTACAAGAATGTGTTCAAGAAGTATGAGGTGCTGGCACTCCTCTACCATGAACCCCCCGAGGATGACAAGGCCTCACAAAGACAATTTGAGATGGAGGAGCTGATCCTGGAGTTAGCAGCCCAAGTCCTAGAAGACAAGGGTGTTGGCTTCGGGCTGGTAGACTCTGAGAAGGATGCAGCTGTGGCCAAGAAACTAGGCCTAACTGAAGTGGACAGCATGTATGTATTCAAGGGAGATGAAGTCATTGAGTACGATGGCGAGTTTTCTGCTGACACCATCGTGGAGTTTCTGCTTGATGTCCTAGAGGACCCTGTGGAATTGATTGAAGGTGAACGAGAGCTGCAGGCGTTTGAGAATATTGAGGATGAGATCAAACTCATTGGCTACTTCAAGAGCAAAGACTCAGAGCATTACAAAGCCTTCGAGGATGCAGCTGAGGAGTTTCATCCCTACATCCCCTTCTTCGCCACCTTCGACAGCAAGGTGGCAAAGAAGCTGACCCTGAAGCTGAATGAGATTGATTTCTACGAGGCCTTCATGGAAGAGCCTGTGACCATCCCAGACAAGCCCAATAGCGAAGAGGAGATTGTCAACTTCGTGGAGGAGCACAGGAGATCAACCCTGAGGAAACTGAAGCCGGAGAGTATGTATGAGACCTGGGAGGATGATATGGATGGAATCCACATTGTGGCCTTCGCAGAGGAAGCTGATCCTGATGGTTTCGAGTTCTTAGAGACTCTCAAGGCTGTGGCCCAAGATAACACTGAAAACCCAGATCTTAGCATCATCTGGATTGACCCTGATGACTTCCCCCTGCTGGTCCCATACTGGGAGAAGACGTTTGACATCGACTTGTCAGCCCCACAAATAGGAGTCGTCAATGTTACTGATGCGGATAGCGTATGGATGGAAATGGACGATGAGGAGGACCTGCCTTCTGCTGAGGAGCTGGAGGACTGGCTGGAGGATGTCCTGGAGGGCGAGATCAACACAGAGGACGATGACGATGATGATGATGACTAG

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-SE1523-Ab Anti-CASQ1/ CASQ/ PDIB1 functional antibody
    Target Antigen GM-Tg-g-SE1523-Ag CASQ1 protein
    ORF Viral Vector pGMLP001375 Human CASQ1 Lentivirus plasmid
    ORF Viral Vector vGMLP001375 Human CASQ1 Lentivirus particle


    Target information

    Target ID GM-SE1523
    Target Name CASQ1
    Gene ID 844, 12372, 720233, 686019, 101091082, 608401, 508394, 100058343
    Gene Symbol and Synonyms CASQ,CASQ1,CSQ,CSQ-1,CSQ1,PDIB1,sCSQ,VMCQA
    Uniprot Accession P31415
    Uniprot Entry Name CASQ1_HUMAN
    Protein Sub-location Secreted Protein/Potential Cytokines
    Category Not Available
    Disease Not Available
    Gene Ensembl ENSG00000143318
    Target Classification Not Available

    This gene encodes the skeletal muscle specific member of the calsequestrin protein family. Calsequestrin functions as a luminal sarcoplasmic reticulum calcium sensor in both cardiac and skeletal muscle cells. This protein, also known as calmitine, functions as a calcium regulator in the mitochondria of skeletal muscle. This protein is absent in patients with Duchenne and Becker types of muscular dystrophy. [provided by RefSeq, Jun 2013]



    About GMVC

    GDU



    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.