Human CTBS/CTB ORF/cDNA clone-Lentivirus plasmid (NM_004388)

Pre-made Human CTBS/CTB Lentiviral expression plasmid for CTBS lentivirus packaging, CTBS lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.

Target products collectionGo to CTBS/CTB products collection >>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)



Product information

Catalog No. Product Name Plasmid Grade Plasmid quantity
pGMLP001382 Human CTBS Lentivirus plasmid Research Grade 10mg, 50mg, 100mg, 500mg, >1g
GMP-like Grade 10mg, 50mg, 100mg, 500mg, >1g
High Quality (HQ) Grade
Seed 5ug


Product Description

Catalog ID pGMLP001382
Gene Name CTBS
Accession Number NM_004388
Gene ID 1486
Species Human
Product Type Lentivirus plasmid (overexpression)
Insert Length 1158 bp
Gene Alias CTB
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
Sequence ATGTCCCGGCCGCAGCTTCGACGCTGGCGCCTCGTCTCTAGCCCGCCGAGCGGCGTCCCGGGTCTAGCGCTGCTGGCGCTGCTGGCGCTGCTGGCGCTGCGGCTCGCGGCCGGGACCGACTGCCCATGCCCGGAGCCTGAGCTCTGCCGCCCGATTCGCCACCATCCAGATTTCGAGGTCTTTGTGTTTGATGTTGGACAGAAAACTTGGAAATCTTATGATTGGTCACAGATTACAACTGTGGCAACATTTGGAAAATATGACTCAGAACTTATGTGCTACGCTCATTCAAAAGGAGCCAGAGTAGTACTTAAAGGAGATGTATCCTTAAAGGATATCATTGATCCTGCTTTCAGAGCATCCTGGATAGCTCAAAAACTTAATTTGGCCAAAACACAATATATGGATGGAATTAATATAGATATAGAGCAAGAAGTTAATTGTTTATCACCTGAATATGATGCATTAACTGCTTTAGTCAAAGAAACTACAGACTCTTTCCATCGTGAAATTGAGGGATCACAGGTAACCTTTGATGTAGCTTGGTCTCCAAAGAACATAGACAGAAGATGCTATAATTATACTGGAATCGCAGATGCTTGTGACTTCCTCTTTGTGATGTCTTATGATGAACAAAGTCAGATCTGGTCAGAATGTATTGCAGCAGCCAATGCTCCCTATAATCAGACATTAACTGGATATAATGACTACATCAAGATGAGCATTAATCCTAAGAAACTTGTAATGGGTGTTCCTTGGTATGGTTATGATTATACCTGCCTGAATCTGTCTGAGGATCATGTTTGTACCATTGCAAAAGTCCCTTTCCGGGGGGCTCCTTGTAGTGACGCTGCAGGACGTCAGGTGCCCTACAAAACGATCATGAAGCAAATAAATAGTTCTATTTCTGGAAACCTATGGGATAAAGATCAGCGGGCTCCTTATTATAACTATAAAGATCCTGCTGGCCACTTTCATCAAGTATGGTATGATAACCCTCAGAGTATTTCTTTAAAGGCAACATATATACAAAACTATCGCTTACGGGGCATTGGCATGTGGAATGCAAACTGTCTTGACTACTCTGGAGATGCTGTAGCCAAACAGCAAACTGAAGAAATGTGGGAAGTCTTAAAGCCAAAGCTGTTACAGAGATGA

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-SE1470-Ab Anti-DIAC/ CTBS/ CTB functional antibody
    Target Antigen GM-Tg-g-SE1470-Ag CTBS protein
    ORF Viral Vector pGMLP001382 Human CTBS Lentivirus plasmid
    ORF Viral Vector vGMLP001382 Human CTBS Lentivirus particle


    Target information

    Target ID GM-SE1470
    Target Name CTBS
    Gene ID 1486, 74245, 710366, 81652, 109502427, 490188, 524503, 100064763
    Gene Symbol and Synonyms 2210401K11Rik,CTB,CTBS
    Uniprot Accession Q01459
    Uniprot Entry Name DIAC_HUMAN
    Protein Sub-location Secreted Protein/Potential Cytokines
    Category Not Available
    Disease Not Available
    Gene Ensembl ENSG00000117151
    Target Classification Not Available

    Chitobiase is a lysosomal glycosidase involved in degradation of asparagine-linked oligosaccharides on glycoproteins (Aronson and Kuranda, 1989 [PubMed 2531691]).[supplied by OMIM, Nov 2010]



    About GMVC

    GDU



    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.