Human PROKR1/GPR73/GPR73a ORF/cDNA clone-Lentivirus plasmid (NM_138964)

Cat. No.: pGMLP001416
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days

Pre-made Human PROKR1/GPR73/GPR73a Lentiviral expression plasmid for PROKR1 lentivirus packaging, PROKR1 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.


Target products collection

Go to PROKR1/GPR73 products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Purchase
Total Price: $630.96
Shipping fee: Limited-time free
For payment issues, contact us.


Product Description

Catalog ID pGMLP001416
Gene Name PROKR1
Accession Number NM_138964
Gene ID 10887
Species Human
Product Type Lentivirus plasmid (overexpression)
Insert Length 1182 bp
Gene Alias GPR73,GPR73a,PK-R1,PKR1,ZAQ
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGGAGACCACCATGGGGTTCATGGATGACAATGCCACCAACACTTCCACCAGCTTCCTTTCTGTGCTCAACCCTCATGGAGCCCATGCCACTTCCTTCCCATTCAACTTCAGCTACAGCGACTATGATATGCCTTTGGATGAAGATGAGGATGTGACCAATTCCAGGACGTTCTTTGCTGCCAAGATTGTCATTGGGATGGCCCTGGTGGGCATCATGCTGGTCTGCGGCATTGGAAACTTCATCTTTATCGCTGCCCTGGTCCGCTACAAGAAACTGCGCAACCTCACCAACCTGCTCATCGCCAACCTGGCCATCTCTGACTTCCTGGTGGCCATTGTCTGCTGCCCCTTTGAGATGGACTACTATGTGGTGCGCCAGCTCTCCTGGGAGCACGGCCACGTCCTGTGCACCTCTGTCAACTACCTGCGCACTGTCTCTCTCTATGTCTCCACCAATGCCCTGCTGGCCATCGCCATTGACAGGTATCTGGCTATTGTCCATCCGCTGAGACCACGGATGAAGTGCCAAACAGCCACTGGCCTGATTGCCTTGGTGTGGACGGTGTCCATCCTGATCGCCATCCCTTCCGCCTACTTCACCACCGAGACGGTCCTCGTCATTGTCAAGAGCCAGGAAAAGATCTTCTGCGGCCAGATCTGGCCTGTGGACCAGCAGCTCTACTACAAGTCCTACTTCCTCTTTATCTTTGGCATAGAATTCGTGGGCCCCGTGGTCACCATGACCCTGTGCTATGCCAGGATCTCCCGGGAGCTCTGGTTCAAGGCGGTCCCTGGATTCCAGACAGAGCAGATCCGCAAGAGGCTGCGCTGCCGCAGGAAGACGGTCCTGGTGCTCATGTGCATCCTCACCGCCTACGTGCTATGCTGGGCGCCCTTCTACGGCTTCACCATCGTGCGCGACTTCTTCCCCACCGTGTTTGTGAAGGAGAAGCACTACCTCACTGCCTTCTACATCGTCGAGTGCATCGCCATGAGCAACAGCATGATCAACACTCTGTGCTTCGTGACCGTCAAGAACGACACCGTCAAGTACTTCAAAAAGATCATGTTGCTCCACTGGAAGGCTTCTTACAATGGCGGTAAGTCCAGTGCAGACCTGGACCTCAAGACAATTGGGATGCCTGCCACCGAAGAGGTGGACTGCATCAGACTAAAATAA
ORF Protein Sequence METTMGFMDDNATNTSTSFLSVLNPHGAHATSFPFNFSYSDYDMPLDEDEDVTNSRTFFAAKIVIGMALVGIMLVCGIGNFIFIAALVRYKKLRNLTNLLIANLAISDFLVAIVCCPFEMDYYVVRQLSWEHGHVLCTSVNYLRTVSLYVSTNALLAIAIDRYLAIVHPLRPRMKCQTATGLIALVWTVSILIAIPSAYFTTETVLVIVKSQEKIFCGQIWPVDQQLYYKSYFLFIFGIEFVGPVVTMTLCYARISRELWFKAVPGFQTEQIRKRLRCRRKTVLVLMCILTAYVLCWAPFYGFTIVRDFFPTVFVKEKHYLTAFYIVECIAMSNSMINTLCFVTVKNDTVKYFKKIMLLHWKASYNGGKSSADLDLKTIGMPATEEVDCIRLK

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-T85115-Ab Anti-PKR1/ PROKR1/ GPR73 monoclonal antibody
    Target Antigen GM-Tg-g-T85115-Ag PROKR1 VLP (virus-like particle)
    ORF Viral Vector pGMLP001416 Human PROKR1 Lentivirus plasmid
    ORF Viral Vector vGMLP001416 Human PROKR1 Lentivirus particle


    Target information

    Target ID GM-T85115
    Target Name PROKR1
    Gene ID 10887, 58182, 699574, 192648, 101091781, 481406, 281800, 100061616
    Gene Symbol and Synonyms EG-VEGFR1,GPR73,GPR73a,PK-R1,PKR1,PROKR1,ZAQ
    Uniprot Accession Q8TCW9
    Uniprot Entry Name PKR1_HUMAN
    Protein Sub-location Transmembrane Protein
    Category Therapeutics Target
    Disease Not Available
    Gene Ensembl ENSG00000169618
    Target Classification GPCR

    This gene encodes a member of the G-protein-coupled receptor family. The encoded protein binds to prokineticins (1 and 2), leading to the activation of MAPK and STAT signaling pathways. Prokineticins are protein ligands involved in angiogenesis and inflammation. The encoded protein is expressed in peripheral tissues such as those comprising the circulatory system, lungs, reproductive system, endocrine system and the gastrointestinal system. The protein may be involved in signaling in human fetal ovary during initiation of primordial follicle formation. Sequence variants in this gene may be associated with recurrent miscarriage. [provided by RefSeq, Aug 2016]



    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.