Human BMP10 ORF/cDNA clone-Lentivirus plasmid (NM_014482)

Cat. No.: pGMLP001458
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days

Pre-made Human BMP10/ Lentiviral expression plasmid for BMP10 lentivirus packaging, BMP10 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.


Target products collection

Go to BMP10/ products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Purchase
Total Price: $657
Shipping fee: Limited-time free
For payment issues, contact us.


Product Description

Catalog ID pGMLP001458
Gene Name BMP10
Accession Number NM_014482
Gene ID 27302
Species Human
Product Type Lentivirus plasmid (overexpression)
Insert Length 1275 bp
Gene Alias
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGGGCTCTCTGGTCCTGACACTGTGCGCTCTTTTCTGCCTGGCAGCTTACTTGGTTTCTGGCAGCCCCATCATGAACCTAGAGCAGTCTCCTCTGGAAGAAGATATGTCCCTCTTTGGTGATGTTTTCTCAGAGCAAGACGGTGTCGACTTTAACACACTGCTCCAGAGCATGAAGGATGAGTTTCTTAAGACACTAAACCTCTCTGACATCCCCACGCAGGATTCAGCCAAGGTGGACCCACCAGAGTACATGTTGGAACTCTACAACAAATTTGCAACAGATCGGACCTCCATGCCCTCTGCCAACATCATTAGGAGTTTCAAGAATGAAGATCTGTTTTCCCAGCCGGTCAGTTTTAATGGGCTCCGAAAATACCCCCTCCTCTTCAATGTGTCCATTCCTCACCATGAAGAGGTCATCATGGCTGAACTTAGGCTATACACACTGGTGCAAAGGGATCGTATGATATACGATGGAGTAGACCGGAAAATTACCATTTTTGAAGTGCTGGAGAGCAAAGGGGATAATGAGGGAGAAAGAAACATGCTGGTCTTGGTGTCTGGGGAGATATATGGAACCAACAGTGAGTGGGAGACTTTTGATGTCACAGATGCCATCAGACGTTGGCAAAAGTCAGGCTCATCCACCCACCAGCTGGAGGTCCACATTGAGAGCAAACACGATGAAGCTGAGGATGCCAGCAGTGGACGGCTAGAAATAGATACCAGTGCCCAGAATAAGCATAACCCTTTGCTCATCGTGTTTTCTGATGACCAAAGCAGTGACAAGGAGAGGAAGGAGGAACTGAATGAAATGATTTCCCATGAGCAACTTCCAGAGCTGGACAACTTGGGCCTGGATAGCTTTTCCAGTGGACCTGGGGAAGAGGCTTTGTTGCAGATGAGATCAAACATCATCTATGACTCCACTGCCCGAATCAGAAGGAACGCCAAAGGAAACTACTGTAAGAGGACCCCGCTCTACATCGACTTCAAGGAGATTGGGTGGGACTCCTGGATCATCGCTCCGCCTGGATACGAAGCCTATGAATGCCGTGGTGTTTGTAACTACCCCCTGGCAGAGCATCTCACACCCACAAAGCATGCAATTATCCAGGCCTTGGTCCACCTCAAGAATTCCCAGAAAGCTTCCAAAGCCTGCTGTGTGCCCACAAAGCTAGAGCCCATCTCCATCCTCTATTTAGACAAAGGCGTCGTCACCTACAAGTTTAAATACGAAGGCATGGCCGTCTCCGAATGTGGCTGTAGATAG
ORF Protein Sequence MGSLVLTLCALFCLAAYLVSGSPIMNLEQSPLEEDMSLFGDVFSEQDGVDFNTLLQSMKDEFLKTLNLSDIPTQDSAKVDPPEYMLELYNKFATDRTSMPSANIIRSFKNEDLFSQPVSFNGLRKYPLLFNVSIPHHEEVIMAELRLYTLVQRDRMIYDGVDRKITIFEVLESKGDNEGERNMLVLVSGEIYGTNSEWETFDVTDAIRRWQKSGSSTHQLEVHIESKHDEAEDASSGRLEIDTSAQNKHNPLLIVFSDDQSSDKERKEELNEMISHEQLPELDNLGLDSFSSGPGEEALLQMRSNIIYDSTARIRRNAKGNYCKRTPLYIDFKEIGWDSWIIAPPGYEAYECRGVCNYPLAEHLTPTKHAIIQALVHLKNSQKASKACCVPTKLEPISILYLDKGVVTYKFKYEGMAVSECGCR

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Biosimilar GMP-Bios-INN-791 Pre-Made Dalantercept biosimilar, Fusion Protein: Recombinant therapeutic protein targeting BMP10 fused with human IGHG1 Fc (Fragment constant)
    Target Antibody GM-Tg-g-T19110-Ab Anti-BMP10 functional antibody
    Target Antigen GM-Tg-g-T19110-Ag BMP10 protein
    ORF Viral Vector pGMLP001458 Human BMP10 Lentivirus plasmid
    ORF Viral Vector vGMLP001458 Human BMP10 Lentivirus particle


    Target information

    Target ID GM-T19110
    Target Name BMP10
    Gene ID 27302, 12154, 700068, 500245, 111559830, 481408, 538874, 100050890
    Gene Symbol and Synonyms b2b2711Clo,BMP10
    Uniprot Accession O95393
    Uniprot Entry Name BMP10_HUMAN
    Protein Sub-location Secreted Protein/Potential Cytokines
    Category Therapeutics Target, INN Index
    Disease Not Available
    Gene Ensembl ENSG00000163217
    Target Classification Not Available

    This gene encodes a secreted ligand of the TGF-beta (transforming growth factor-beta) superfamily of proteins. Ligands of this family bind various TGF-beta receptors leading to recruitment and activation of SMAD family transcription factors that regulate gene expression. The encoded preproprotein is proteolytically processed to generate the mature protein, which binds to the activin receptor-like kinase 1 (ALK1) and plays important roles in cardiovascular development including cardiomyocyte proliferation and regulation of heart size, closure of the ductus arteriosus, angiogenesis and ventricular trabeculation. [provided by RefSeq, Aug 2016]



    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.