Human CHRNA7/CHRNA7-2/ NACHRA7 ORF/cDNA clone-Lentivirus plasmid (NM_000746)

Pre-made Human CHRNA7/CHRNA7-2/ NACHRA7 Lentiviral expression plasmid for CHRNA7 lentivirus packaging, CHRNA7 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.

Target products collectionGo to CHRNA7/CHRNA7-2 products collection >>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)



Product information

Catalog No. Product Name Plasmid Grade Plasmid quantity
pGMLP001474 Human CHRNA7 Lentivirus plasmid Research Grade 10mg, 50mg, 100mg, 500mg, >1g
GMP-like Grade 10mg, 50mg, 100mg, 500mg, >1g
High Quality (HQ) Grade
Seed 5ug


Product Description

Catalog ID pGMLP001474
Gene Name CHRNA7
Accession Number NM_000746
Gene ID 1139
Species Human
Product Type Lentivirus plasmid (overexpression)
Insert Length 1509 bp
Gene Alias CHRNA7-2, NACHRA7
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
Sequence ATGCGCTGCTCGCCGGGAGGCGTCTGGCTGGCGCTGGCCGCGTCGCTCCTGCACGTGTCCCTGCAAGGCGAGTTCCAGAGGAAGCTTTACAAGGAGCTGGTCAAGAACTACAATCCCTTGGAGAGGCCCGTGGCCAATGACTCGCAACCACTCACCGTCTACTTCTCCCTGAGCCTCCTGCAGATCATGGACGTGGATGAGAAGAACCAAGTTTTAACCACCAACATTTGGCTGCAAATGTCTTGGACAGATCACTATTTACAGTGGAATGTGTCAGAATATCCAGGGGTGAAGACTGTTCGTTTCCCAGATGGCCAGATTTGGAAACCAGACATTCTTCTCTATAACAGTGCTGATGAGCGCTTTGACGCCACATTCCACACTAACGTGTTGGTGAATTCTTCTGGGCATTGCCAGTACCTGCCTCCAGGCATATTCAAGAGTTCCTGCTACATCGATGTACGCTGGTTTCCCTTTGATGTGCAGCACTGCAAACTGAAGTTTGGGTCCTGGTCTTACGGAGGCTGGTCCTTGGATCTGCAGATGCAGGAGGCAGATATCAGTGGCTATATCCCCAATGGAGAATGGGACCTAGTGGGAATCCCCGGCAAGAGGAGTGAAAGGTTCTATGAGTGCTGCAAAGAGCCCTACCCCGATGTCACCTTCACAGTGACCATGCGCCGCAGGACGCTCTACTATGGCCTCAACCTGCTGATCCCCTGTGTGCTCATCTCCGCCCTCGCCCTGCTGGTGTTCCTGCTTCCTGCAGATTCCGGGGAGAAGATTTCCCTGGGGATAACAGTCTTACTCTCTCTTACCGTCTTCATGCTGCTCGTGGCTGAGATCATGCCCGCAACATCCGATTCGGTACCATTGATAGCCCAGTACTTCGCCAGCACCATGATCATCGTGGGCCTCTCGGTGGTGGTGACAGTGATCGTGCTGCAGTACCACCACCACGACCCCGACGGGGGCAAGATGCCCAAGTGGACCAGAGTCATCCTTCTGAACTGGTGCGCGTGGTTCCTGCGAATGAAGAGGCCCGGGGAGGACAAGGTGCGCCCGGCCTGCCAGCACAAGCAGCGGCGCTGCAGCCTGGCCAGTGTGGAGATGAGCGCCGTGGCGCCGCCGCCCGCCAGCAACGGGAACCTGCTGTACATCGGCTTCCGCGGCCTGGACGGCGTGCACTGTGTCCCGACCCCCGACTCTGGGGTAGTGTGTGGCCGCATGGCCTGCTCCCCCACGCACGATGAGCACCTCCTGCACGGCGGGCAACCCCCCGAGGGGGACCCGGACTTGGCCAAGATCCTGGAGGAGGTCCGCTACATTGCCAACCGCTTCCGCTGCCAGGACGAAAGCGAGGCGGTCTGCAGCGAGTGGAAGTTCGCCGCCTGTGTGGTGGACCGCCTGTGCCTCATGGCCTTCTCGGTCTTCACCATCATCTGCACCATCGGCATCCTGATGTCGGCTCCCAACTTCGTGGAGGCCGTGTCCAAAGACTTTGCGTAA

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-T34429-Ab Anti-ACHA7/ CHRNA7/ CHRNA7-2 monoclonal antibody
    Target Antigen GM-Tg-g-T34429-Ag CHRNA7 VLP (virus-like particle)
    ORF Viral Vector pGMPC000613 Human CHRNA7 Mammalian (Non-Viral Vector) plasmid
    ORF Viral Vector pGMLP001474 Human CHRNA7 Lentivirus plasmid
    ORF Viral Vector vGMLP001474 Human CHRNA7 Lentivirus particle


    Target information

    Target ID GM-T34429
    Target Name CHRNA7
    Gene ID 1139, 574230, 25302, 751113, 488696
    Gene Symbol and Synonyms BTX,CHRNA7,CHRNA7-2,NACHRA7,NARAD,nica7
    Uniprot Accession P36544
    Uniprot Entry Name ACHA7_HUMAN
    Protein Sub-location Transmembrane Protein
    Category Therapeutics Target
    Disease Not Available
    Gene Ensembl ENSG00000175344
    Target Classification Ion Channel

    The nicotinic acetylcholine receptors (nAChRs) are members of a superfamily of ligand-gated ion channels that mediate fast signal transmission at synapses. The nAChRs are thought to be hetero-pentamers composed of homologous subunits. The proposed structure for each subunit is a conserved N-terminal extracellular domain followed by three conserved transmembrane domains, a variable cytoplasmic loop, a fourth conserved transmembrane domain, and a short C-terminal extracellular region. The protein encoded by this gene forms a homo-oligomeric channel, displays marked permeability to calcium ions and is a major component of brain nicotinic receptors that are blocked by, and highly sensitive to, alpha-bungarotoxin. Once this receptor binds acetylcholine, it undergoes an extensive change in conformation that affects all subunits and leads to opening of an ion-conducting channel across the plasma membrane. This gene is located in a region identified as a major susceptibility locus for juvenile myoclonic epilepsy and a chromosomal location involved in the genetic transmission of schizophrenia. An evolutionarily recent partial duplication event in this region results in a hybrid containing sequence from this gene and a novel FAM7A gene. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2012]



    About GMVC

    GDU



    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.